SGN Marker C2_At4g34215

SGN-M8466
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle302303 (SGN)
120807 (CGN)
---
Lycopersicon CombinedSingleSGN-U220941---
Solanum tuberosumSingleSGN-U251193---
ArabidopsisSingleAt4g34215 on TAIR---
Mapped locations  
Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46735)
Chromosome
6
Position
43.00 cM
Confidence
I(LOD2)
Protocol
CAPS


Tobacco N. tomentosiformis

Map: Tobacco N. acuminata   
Map version
89 (location: 46518)
Chromosome
6
Position
58.10 cM
Confidence
F(LOD3)
Protocol
dCAPS


Tobacco N. acuminata

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38711)
Chromosome
6
Position
69.00 cM
Confidence
I(LOD2)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39881
Forward primer (5'-3')
TACTCTGGGCAAAGCAACATGGC
Accessions and product sizes
Solanum lycopersicum TA209
800
Solanum pennellii TA56
800
Approximate temperature
53°C
Reverse primer (5'-3')
ATGGCAGATGCAAATCAGCACG
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
500
Solanum lycopersicum TA209
800
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26910)
Chromosome
4
Position
16.38 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 32539
Forward primer (5'-3')
TACTCTGGGCAAAGCAACATGGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATGGCAGATGCAAATCAGCACG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 32540
Forward primer (5'-3')
TACTCTGGGCAAAGCAACATGGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATGGCAGATGCAAATCAGCACG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 32541
Forward primer (5'-3')
TACTCTGGGCAAAGCAACATGGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATGGCAGATGCAAATCAGCACG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 32542
Forward primer (5'-3')
TACTCTGGGCAAAGCAACATGGC
Digested band sizes (using NsiI)
Solanum pennellii LA716: 400
Solanum lycopersicum LA925: 500
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATGGCAGATGCAAATCAGCACG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 500
Solanum pennellii LA716: 500
Approximate temperature
55°C
  
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text

Genomic location of C2_At4g34215  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8466 marker 8466
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)