SGN Marker C2_At4g35930

SGN-M8486
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle311540 (SGN)
128097 (CGN)
---
Capsicum annuumSingleSGN-U200906---
Lycopersicon CombinedSingleSGN-U221671---
ArabidopsisSingleAt4g35930 on TAIR---
Mapped locations  
Map: Solanum michoacanum 2011   
Map version
155 (location: 109244)
Chromosome
3
Position
7.20 cM
Confidence
uncalculated
Protocol
CAPS


Solanum michoacanum 2011

Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46736)
Chromosome
9
Position
52.90 cM
Confidence
CF(LOD3)
Protocol
CAPS


Tobacco N. tomentosiformis

Map: Tobacco N. acuminata   
Map version
89 (location: 46519)
Chromosome
9
Position
50.50 cM
Confidence
CF(LOD3)
Protocol
CAPS


Tobacco N. acuminata

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38717)
Chromosome
3
Position
52.50 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39887
Forward primer (5'-3')
ACTAAGGCATCAGCTGCTAAATCTTG
Accessions and product sizes
Approximate temperature
Unknown
Reverse primer (5'-3')
TTGCCTGAATTACTGCCTTCCTG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26931)
Chromosome
4
Position
17.02 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 32547
Forward primer (5'-3')
ACTAAGGCATCAGCTGCTAAATCTTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTGCCTGAATTACTGCCTTCCTG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1250
Approximate temperature
55°C
  
PCR data   Exp. ID 32548
Forward primer (5'-3')
ACTAAGGCATCAGCTGCTAAATCTTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTGCCTGAATTACTGCCTTCCTG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1250
Approximate temperature
55°C
  
PCR data   Exp. ID 32549
Forward primer (5'-3')
ACTAAGGCATCAGCTGCTAAATCTTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTGCCTGAATTACTGCCTTCCTG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 1250
Approximate temperature
55°C
  
PCR data   Exp. ID 32550
Forward primer (5'-3')
ACTAAGGCATCAGCTGCTAAATCTTG
Digested band sizes (using HincII)
Solanum lycopersicum LA925: 425+800
Solanum pennellii LA716: 450+800
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTGCCTGAATTACTGCCTTCCTG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1250
Solanum lycopersicum LA925: 1250
Approximate temperature
55°C
  
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 
Forward amplicon sequence for S. hirtum 130005 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, plain text
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text
Forward amplicon sequence for S. betaceum 6002061 plant #4, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4, plain text
Forward amplicon sequence for S. uniloba 6002078 plant #6, AB1 chromatogram - [View]
Forward amplicon sequence for S. uniloba 6002078 plant #6, plain text
Forward amplicon sequence for S. quitoense SE plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense SE plant #1, plain text

Genomic location of C2_At4g35930  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8486 marker 8486
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)