SGN Marker C2_At4g36970

SGN-M8496
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle303106 (SGN)
122611 (CGN)
---
Lycopersicon CombinedMultipleSGN-U220105---
Solanum tuberosumSingleSGN-U253623---
ArabidopsisSingleAt4g36970 on TAIR---
Mapped locations  
Map: Arabidopsis COSII   
Map version
44 (location: 26941)
Chromosome
4
Position
17.43 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII

PCR data   Exp. ID 41640
Forward primer (5'-3')
TCAGTGAATCTTCAGTACCAAGCTCTC
Accessions and product sizes
Solanum pennellii TA56
400
Solanum lycopersicum TA209
400
Approximate temperature
55°C
Reverse primer (5'-3')
AGATGACCTTTCCTGGGGAGATG
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
250
Solanum lycopersicum TA209
275
Mg+2 concentration
1.5mM
   Enzymes
  
Other PCR data 
PCR data   Exp. ID 32551
Forward primer (5'-3')
TCAGTGAATCTTCAGTACCAAGCTCTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGATGACCTTTCCTGGGGAGATG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 875
Approximate temperature
55°C
  
PCR data   Exp. ID 32552
Forward primer (5'-3')
TCAGTGAATCTTCAGTACCAAGCTCTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGATGACCTTTCCTGGGGAGATG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 875
Approximate temperature
55°C
  
PCR data   Exp. ID 32553
Forward primer (5'-3')
TCAGTGAATCTTCAGTACCAAGCTCTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGATGACCTTTCCTGGGGAGATG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 875
Approximate temperature
55°C
  
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Genomic location of C2_At4g36970  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8496 marker 8496
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)