SGN Marker C2_At4g37130

SGN-M8500
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle310758 (SGN)
132115 (CGN)
---
Lycopersicon CombinedSingleSGN-U229263---
Solanum tuberosumMultipleSGN-U263193---
ArabidopsisSingleAt4g37130 on TAIR---
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49285)
Chromosome
2
Position
46.43 MB
Confidence
uncalculated
Protocol
CAPS


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47225)
Chromosome
2
Position
129.47 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46737)
Chromosome
2
Position
12.40 cM
Confidence
F(LOD3)
Protocol
CAPS


Tobacco N. tomentosiformis

Map: Pepper-COSII   
Map version
58 (location: 41498)
Chromosome
2
Position
118.00 cM
Confidence
F(LOD3)
Protocol
dCAPS


Pepper-COSII

PCR data   Exp. ID 43474
Forward primer (5'-3')
CTTTGCCTTCTTTAAGTATGCTTATATATG
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
TGCTGTTTTCATTGATTCAATGTACTG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38720)
Chromosome
2
Position
116.00 cM
Confidence
F(LOD3)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39890
Forward primer (5'-3')
TTACAGCAAACTGTAGCAAGATTTGAG
Accessions and product sizes
Approximate temperature
Unknown
Reverse primer (5'-3')
TGCTGTTTTCATTGATTCAATGTACTG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26945)
Chromosome
4
Position
17.49 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 32556
Forward primer (5'-3')
TTACAGCAAACTGTAGCAAGATTTGAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCTGTTTTCATTGATTCAATGTACTG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1300
Approximate temperature
55°C
  
PCR data   Exp. ID 32557
Forward primer (5'-3')
TTACAGCAAACTGTAGCAAGATTTGAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCTGTTTTCATTGATTCAATGTACTG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1100
Approximate temperature
55°C
  
PCR data   Exp. ID 32558
Forward primer (5'-3')
TTACAGCAAACTGTAGCAAGATTTGAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCTGTTTTCATTGATTCAATGTACTG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 1100
Approximate temperature
55°C
  
PCR data   Exp. ID 32559
Forward primer (5'-3')
TTACAGCAAACTGTAGCAAGATTTGAG
Digested band sizes (using amplicon difference)
Solanum lycopersicum LA925: 1100
Solanum pennellii LA716: 1300
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCTGTTTTCATTGATTCAATGTACTG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1300
Solanum lycopersicum LA925: 1100
Approximate temperature
55°C
  
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text
Forward amplicon sequence for S. betaceum 6002061 plant #4, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4, plain text
Forward amplicon sequence for S. uniloba 6002078 plant #6, AB1 chromatogram - [View]
Forward amplicon sequence for S. uniloba 6002078 plant #6, plain text

Genomic location of C2_At4g37130  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8500 marker 8500
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)