SGN Marker C2_At4g37300

SGN-M8504
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle302273 (SGN)
120410 (CGN)
---
Capsicum annuumSingleSGN-U198583---
Lycopersicon CombinedSingleSGN-U218585---
Solanum tuberosumMultipleSGN-U246967---
ArabidopsisSingleAt4g37300 on TAIR---
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49286)
Chromosome
2
Position
48.41 MB
Confidence
uncalculated
Protocol
CAPS


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47226)
Chromosome
2
Position
146.23 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38722)
Chromosome
2
Position
132.00 cM
Confidence
F(LOD3)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39892
Forward primer (5'-3')
TGGTTTCCATTGACAAACAGCATCACAC
Accessions and product sizes
Solanum pennellii TA56
500
Solanum lycopersicum TA209
500
Approximate temperature
55°C
Reverse primer (5'-3')
ACCTGATAATCATCTTTACTCGGAATCC
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
500
Solanum pennellii TA56
400
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26949)
Chromosome
4
Position
17.56 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 32560
Forward primer (5'-3')
TGGTTTCCATTGACAAACAGCATCACAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACCTGATAATCATCTTTACTCGGAATCC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 450
Approximate temperature
55°C
  
PCR data   Exp. ID 32561
Forward primer (5'-3')
TGGTTTCCATTGACAAACAGCATCACAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACCTGATAATCATCTTTACTCGGAATCC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 425
Approximate temperature
55°C
  
PCR data   Exp. ID 32562
Forward primer (5'-3')
TGGTTTCCATTGACAAACAGCATCACAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACCTGATAATCATCTTTACTCGGAATCC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 425
Approximate temperature
55°C
  
PCR data   Exp. ID 32563
Forward primer (5'-3')
TGGTTTCCATTGACAAACAGCATCACAC
Digested band sizes (using amplicon difference)
Solanum pennellii LA716: 450
Solanum lycopersicum LA925: 425
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACCTGATAATCATCTTTACTCGGAATCC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 450
Solanum lycopersicum LA925: 425
Approximate temperature
55°C
  
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text

Genomic location of C2_At4g37300  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8504 marker 8504
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)