Notice: Due to a server issue, SGN was unavailable earlier today. We apologize for any inconvenience.

SGN Marker C2_At4g39450

SGN-M8520
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle311916 (SGN)
125787 (CGN)
---
Lycopersicon CombinedSingleSGN-U229013---
ArabidopsisSingleAt4g39450 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38727)
Chromosome
4
Position
56.50 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39896
Forward primer (5'-3')
ACCCCCATGATCTCGATGCATTTG
Accessions and product sizes
Solanum pennellii TA56
350
Solanum lycopersicum TA209
350
Approximate temperature
55°C
Reverse primer (5'-3')
TGGTTAAGACCATAAGCTTCAGCAAC
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
150+200
Solanum lycopersicum TA209
350
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26967)
Chromosome
4
Position
18.35 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 32564
Forward primer (5'-3')
ACCCCCATGATCTCGATGCATTTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGGTTAAGACCATAAGCTTCAGCAAC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 550
Approximate temperature
55°C
  
PCR data   Exp. ID 32565
Forward primer (5'-3')
ACCCCCATGATCTCGATGCATTTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGGTTAAGACCATAAGCTTCAGCAAC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 550
Approximate temperature
55°C
  
PCR data   Exp. ID 32566
Forward primer (5'-3')
ACCCCCATGATCTCGATGCATTTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGGTTAAGACCATAAGCTTCAGCAAC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 550
Approximate temperature
55°C
  
PCR data   Exp. ID 32567
Forward primer (5'-3')
ACCCCCATGATCTCGATGCATTTG
Digested band sizes (using Tsp509I)
Solanum pennellii LA716: 450
Solanum lycopersicum LA925: 400
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGGTTAAGACCATAAGCTTCAGCAAC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 550
Solanum pennellii LA716: 550
Approximate temperature
55°C
  
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 
Forward amplicon sequence for S. betaceum 6002061 plant #4, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4, plain text
Forward amplicon sequence for S. uniloba 6002078 plant #6, AB1 chromatogram - [View]
Forward amplicon sequence for S. uniloba 6002078 plant #6, plain text

Genomic location of C2_At4g39450  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8520 marker 8520
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)