Notice: The FTP site is available again. We apologize for any inconvenience.

SGN Marker C2_At4g39870

SGN-M8528
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle307514 (SGN)
127459 (CGN)
---
Lycopersicon CombinedSingleSGN-U221101---
Solanum tuberosumSingleSGN-U255205---
ArabidopsisSingleAt4g39870 on TAIR---
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49288)
Chromosome
4
Position
52.94 MB
Confidence
uncalculated
Protocol
CAPS


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47228)
Chromosome
4
Position
45.00 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Eggplant-COSII   
Map version
63 (location: 42246)
Chromosome
11
Position
59.70 cM
Confidence
F(LOD3)
Protocol
dCAPS


Eggplant-COSII

PCR data   Exp. ID 43813
Forward primer (5'-3')
TGATGGAAGTAATTCTAAAGTTTCCG
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
TTCTATTCCACATACAAGCAAGCCT
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Pepper-COSII   
Map version
58 (location: 41501)
Chromosome
12
Position
56.50 cM
Confidence
F(LOD3)
Protocol
CAPS


Pepper-COSII

PCR data   Exp. ID 43477
Forward primer (5'-3')
AGACTTAACCAATGCTTCTGTTGGC
Accessions and product sizes
Approximate temperature
60°C
Reverse primer (5'-3')
AACTAGCCCACCAAACACAGCACC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38731)
Chromosome
4
Position
62.70 cM
Confidence
I(LOD2)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39899
Forward primer (5'-3')
TGATGGAAGTAATTCTAAAGTTTCCG
Accessions and product sizes
Solanum lycopersicum TA209
1250
Solanum pennellii TA56
1250
Approximate temperature
55°C
Reverse primer (5'-3')
AACTAGCCCACCAAACACAGCACC
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
425+800
Solanum pennellii TA56
450+800
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26976)
Chromosome
4
Position
18.50 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At4g39870  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8528 marker 8528
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)