SGN Marker C2_At5g01260

SGN-M8535
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle300443 (SGN)
123822 (CGN)
---
Lycopersicon CombinedSingleSGN-U228925---
Solanum tuberosumSingleSGN-U250220---
ArabidopsisSingleAt5g01260 on TAIR---
Mapped locations  
Map: Arabidopsis COSII   
Map version
44 (location: 26983)
Chromosome
5
Position
0.11 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII

PCR data   Exp. ID 41652
Forward primer (5'-3')
AATGGTCGGAGGGACATGTATGG
Accessions and product sizes
Solanum pennellii TA56
850
Solanum lycopersicum TA209
850
Approximate temperature
55°C
Reverse primer (5'-3')
TGCAGCTCAGCATTGTCCCAATC
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
400
Solanum pennellii TA56
850
Mg+2 concentration
1.5mM
   Enzymes
  
Other PCR data 
PCR data   Exp. ID 11612
Forward primer (5'-3')
AATGGTCGGAGGGACATGTATGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCAGCTCAGCATTGTCCCAATC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 250
Approximate temperature
53°C
  
PCR data   Exp. ID 11613
Forward primer (5'-3')
AATGGTCGGAGGGACATGTATGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCAGCTCAGCATTGTCCCAATC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 250
Approximate temperature
53°C
  
PCR data   Exp. ID 11614
Forward primer (5'-3')
AATGGTCGGAGGGACATGTATGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCAGCTCAGCATTGTCCCAATC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 250
Approximate temperature
53°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Amplicon sequence alignment, FASTA
At5g01260F.cds.txt, plain text
Forward amplicon sequence for S. pimpinellifolium LA1589, AB1 chromatogram - [View]
Forward amplicon sequence for S. pimpinellifolium LA1589, plain text
Forward amplicon sequence for S. lycopersicum TA209, AB1 chromatogram - [View]
Forward amplicon sequence for S. lycopersicum TA209, plain text
Forward amplicon sequence for S. pennellii TA56, AB1 chromatogram - [View]
Forward amplicon sequence for S. pennellii TA56, plain text

Genomic location of C2_At5g01260  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8535 marker 8535
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)