SGN Marker C2_At5g03905

SGN-M8565
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle311356 (SGN)
128121 (CGN)
---
Lycopersicon CombinedSingleSGN-U236968---
ArabidopsisSingleAt5g03905 on TAIR---
Mapped locations  
Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46740)
Chromosome
1
Position
46.80 cM
Confidence
CF(LOD3)
Protocol
CAPS


Tobacco N. tomentosiformis

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38741)
Chromosome
10
Position
52.30 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 41664
Forward primer (5'-3')
TGTTGAAGCCGGTGGTTGTTCTGG
Accessions and product sizes
Solanum pennellii TA56
400
Solanum lycopersicum TA209
400
Approximate temperature
55°C
Reverse primer (5'-3')
TCGAATGATACATTATCCACAACCAATTT
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
400
Solanum pennellii TA56
350
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 27014)
Chromosome
5
Position
1.05 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At5g03905  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8565 marker 8565
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)