SGN Marker C2_At5g04270

SGN-M8570
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle301451 (SGN)
122953 (CGN)
---
Solanum tuberosumSingleSGN-U257885---
ArabidopsisSingleAt5g04270 on TAIR---
Mapped locations  
Map: Pepper-COSII   
Map version
58 (location: 41505)
Chromosome
5
Position
114.50 cM
Confidence
F(LOD3)
Protocol
dCAPS


Pepper-COSII

PCR data   Exp. ID 43481
Forward primer (5'-3')
TGGCTTAAGCTTGACACTTGGAACTCTC
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
GATTTACTTGCCAGCCACGCTGCTA
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38743)
Chromosome
5
Position
112.70 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 41667
Forward primer (5'-3')
TGGCTTAAGCTTGACACTTGGAACTCTC
Accessions and product sizes
Solanum pennellii TA56
525
Solanum lycopersicum TA209
525
Approximate temperature
55°C
Reverse primer (5'-3')
AGGGTGATGATAATTTGTCCCAGATTT
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
275
Solanum pennellii TA56
525
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 27019)
Chromosome
5
Position
1.18 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At5g04270  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8570 marker 8570
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)