SGN Marker C2_At5g05270

SGN-M8585
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle300445 (SGN)
124635 (CGN)
---
Lycopersicon CombinedSingleSGN-U219397---
Solanum tuberosumSingleSGN-U250989---
ArabidopsisSingleAt5g05270 on TAIR---
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49289)
Chromosome
5
Position
61.66 MB
Confidence
uncalculated
Protocol
CAPS


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47229)
Chromosome
5
Position
93.00 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46742)
Chromosome
5
Position
17.00 cM
Confidence
F(LOD3)
Protocol
CAPS


Tobacco N. tomentosiformis

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38747)
Chromosome
5
Position
82.50 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 41674
Forward primer (5'-3')
TGGTAAAGAATGAAGTGATGGTGGATG
Accessions and product sizes
Approximate temperature
Unknown
Reverse primer (5'-3')
ACTCCAATTGCTGTGAATTTAATTTG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 27036)
Chromosome
5
Position
1.56 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At5g05270  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8585 marker 8585
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)