SGN Marker SSR188

SGN-M861

SynonymsNone
Locus associationsNone
SSR info 

Annealing temperatures: Low: 55 High: 50
Repeat motif: AT   Repeat number: 11
Repeat motif:    Repeat number:
Forward primer: TGCAGTGAGTCTCGATTTGC
Reverse primer: GGTCTCATTGCAGATAGGGC
Predicted size: 130
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39184)
Chromosome
4
Position
135.50 cM
Confidence
I(LOD2)
Protocol
SSR


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 14108
Forward primer (5'-3')
TGCAGTGAGTCTCGATTTGC
 
 
Mg+2 concentration
Unknown
Reverse primer (5'-3')
GGTCTCATTGCAGATAGGGC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 130+137
Solanum lycopersicum LA925: 130+140
Approximate temperature
50°C
  
PCR data   Exp. ID 67
Forward primer (5'-3')
TGCAGTGAGTCTCGATTTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
GGTCTCATTGCAGATAGGGC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 140+140
Solanum pennellii LA716: 140+148
Approximate temperature
50°C
  
Overgo hybridization and physical mapping 
SSR188 was used as an overgo probe on plate 6 [well E12]

Plausible BAC Matches:   P122J14,   P138D01,   P066I13,   P095G08,   P106H12,   P151C18,   P209D01,   P138B21,   P209H15,   P147J08,   P206I09,   P253C11,   P155I16,   P154K21

 Overgo Sequences

A sequence
ACTTTGGCATGGCATCAGACTCAG
B sequence
CTGATGAGGAAGGATGCTGAGTCT
AB sequence
ACTTTGGCATGGCATCAGACTCAGCATCCT
Marker sequence
GGTCATGTACTACACTCCTCAAATCCTTGAGCAGGCAGGTGTTTGAGTTC
TTCTTTCTAACTTTGGCATGGCATCAGACTCAGCATCCTTCCTCATCAGT
GCGTTAACAAACTTCCTGATGCTCCCTTTGTAGCTATTGCAATGCGATTC
ATGGATGTGGCTGGCAGAAGGTAATGTTCTCTTGATTCCTATCTTCTGCA
TTAGATTAAAGGATGGTTTTGGTTATGTCCTCAAGATTTATTGCTGGAAA
ATCCATGAAATATGTGCAGTGAGTCTCGATTTGCATGTAGGACCATATTT
TTTCCTTATATATGTTCTGGTAGTCTCCTCGGAATATATATATATATATA
TATATCCAAGGTTGGAAAATCGATGCCCTATCTGCAATGAGACCAAATTT
CAAATTGGTTAGTTTTTGAGTTGTGTTTCGTGACAGATAGTATTCTCTCT
GACAAATTTACACAACAAAGATGTGTGACATCATTCTGTTAACAATTAGT
TACTCAAAGTTTATACATTTCAATAATTCAAATTTAATTAACTAATCCAA
TTTAGATGTAGATGAAATTGTCTCTGTCTAACT
Genomic location of SSR188  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D861 marker 861
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)