SGN Marker C2_At5g08430

SGN-M8616
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle309529 (SGN)
128731 (CGN)
---
Solanum tuberosumSingleSGN-U258133---
ArabidopsisSingleAt5g08430 on TAIR---
Mapped locations  
Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46744)
Chromosome
1
Position
10.00 cM
Confidence
CF(LOD3)
Protocol
CAPS


Tobacco N. tomentosiformis

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38763)
Chromosome
1
Position
43.70 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39913
Forward primer (5'-3')
TGAAAGAATAAAAGCTGGTTTGCT
Accessions and product sizes
Approximate temperature
Unknown
Reverse primer (5'-3')
AACTTGTGCTTTTGACTCAAGCTCCA
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 27071)
Chromosome
5
Position
2.72 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At5g08430  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8616 marker 8616
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)