SGN Marker C2_At5g09860

SGN-M8632
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle303222 (SGN)
119761 (CGN)
---
Lycopersicon CombinedSingleSGN-U237538---
ArabidopsisSingleAt5g09860 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38768)
Chromosome
1
Position
92.90 cM
Confidence
I(LOD2)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 41693
Forward primer (5'-3')
ACGATGGAGTCTTGGAAACAAAGAAC
Accessions and product sizes
Approximate temperature
Unknown
Reverse primer (5'-3')
TTCCAGTACTTTGTGATAGCAGGAGT
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 27087)
Chromosome
5
Position
3.07 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At5g09860  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8632 marker 8632
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)