SGN Marker C2_At5g11490

SGN-M8651
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle307805 (SGN)
131420 (CGN)
---
Lycopersicon CombinedSingleSGN-U221223---
ArabidopsisSingleAt5g11490 on TAIR---
Mapped locations  
Map: Pepper-COSII   
Map version
58 (location: 41511)
Chromosome
1
Position
166.80 cM
Confidence
F(LOD3)
Protocol
CAPS


Pepper-COSII

PCR data   Exp. ID 43487
Forward primer (5'-3')
ATGGAGCCATGATTGTATAGCAGTTG
Accessions and product sizes
Approximate temperature
63°C
Reverse primer (5'-3')
AGCTCCCAAGGCTTTCTGAGTCTC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38776)
Chromosome
8
Position
31.50 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39919
Forward primer (5'-3')
ATGGAGCCATGATTGTATAGCAGTTG
Accessions and product sizes
Solanum lycopersicum TA209
300
Solanum pennellii TA56
300
Approximate temperature
55°C
Reverse primer (5'-3')
AGCTCCCAAGGCTTTCTGAGTCTC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 27108)
Chromosome
5
Position
3.67 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 11689
Forward primer (5'-3')
ATGGAGCCATGATTGTATAGCAGTTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCTCCCAAGGCTTTCTGAGTCTC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1500
Approximate temperature
55°C
  
PCR data   Exp. ID 11690
Forward primer (5'-3')
ATGGAGCCATGATTGTATAGCAGTTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCTCCCAAGGCTTTCTGAGTCTC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1500
Approximate temperature
55°C
  
PCR data   Exp. ID 11691
Forward primer (5'-3')
ATGGAGCCATGATTGTATAGCAGTTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCTCCCAAGGCTTTCTGAGTCTC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 1500
Approximate temperature
55°C
  
PCR data   Exp. ID 43816
Forward primer (5'-3')
ATGGAGCCATGATTGTATAGCAGTTG
 
 
Mg+2 concentration
Unknown
Reverse primer (5'-3')
AAGTCATTCACTGACTTGCATCAGCA
Enzymes
  
Accessions and product sizes
Approximate temperature
50°C
  
PCR data   Exp. ID 11692
Forward primer (5'-3')
ATGGAGCCATGATTGTATAGCAGTTG
Digested band sizes (using DraI)
Solanum lycopersicum LA925: 250+350+400+500
Solanum pennellii LA716: 350+1150
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCTCCCAAGGCTTTCTGAGTCTC
Enzymes
All possible enzymes for pennellii and and lycopersicum: RsaI, DraI
All possible enzymes for lycopersicum and pimpinellifolium: BstYI,HincII
  
Accessions and product sizes
Solanum pennellii LA716: 1500
Solanum lycopersicum LA925: 1500
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Amplicon sequence alignment, FASTA
At5g11490F.cds.txt, plain text
Forward amplicon sequence for S. pimpinellifolium LA1589, AB1 chromatogram - [View]
Forward amplicon sequence for S. pimpinellifolium LA1589, plain text
Forward amplicon sequence for S. lycopersicum TA209, AB1 chromatogram - [View]
Forward amplicon sequence for S. lycopersicum TA209, plain text
Forward amplicon sequence for S. hirtum 130005 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, plain text
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text
Forward amplicon sequence for S. quitoense SE plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense SE plant #1, plain text

Genomic location of C2_At5g11490  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8651 marker 8651
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)