SGN Marker C2_At5g12370

SGN-M8665
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle310593 (SGN)
131667 (CGN)
---
Capsicum annuumSingleSGN-U199604---
Lycopersicon CombinedSingleSGN-U223472---
Solanum tuberosumSingleSGN-U266621---
ArabidopsisSingleAt5g12370 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38781)
Chromosome
3
Position
72.50 cM
Confidence
I(LOD2)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39923
Forward primer (5'-3')
AGGGTTGCTGCTGCAGCTGCTTC
Accessions and product sizes
Solanum lycopersicum TA209
450
Solanum pennellii TA56
1400
Approximate temperature
55°C
Reverse primer (5'-3')
TCACCAGCAGCAGCTGCTGCTTC
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
450
Solanum pennellii TA56
1400
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 27123)
Chromosome
5
Position
4.01 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 11700
Forward primer (5'-3')
AGGGTTGCTGCTGCAGCTGCTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCACCAGCAGCAGCTGCTGCTTC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 150
Approximate temperature
55°C
  
PCR data   Exp. ID 11701
Forward primer (5'-3')
AGGGTTGCTGCTGCAGCTGCTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCACCAGCAGCAGCTGCTGCTTC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 150
Approximate temperature
55°C
  
PCR data   Exp. ID 11702
Forward primer (5'-3')
AGGGTTGCTGCTGCAGCTGCTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCACCAGCAGCAGCTGCTGCTTC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 150
Approximate temperature
55°C
  
PCR data   Exp. ID 13699
Forward primer (5'-3')
AGGGTTGCTGCTGCAGCTGCTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCACCAGCAGCAGCTGCTGCTTC
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: 200
Approximate temperature
55°C
  
PCR data   Exp. ID 13700
Forward primer (5'-3')
AGGGTTGCTGCTGCAGCTGCTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCACCAGCAGCAGCTGCTGCTTC
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: 200
Approximate temperature
55°C
  
PCR data   Exp. ID 13701
Forward primer (5'-3')
AGGGTTGCTGCTGCAGCTGCTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCACCAGCAGCAGCTGCTGCTTC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 200
Approximate temperature
55°C
  
PCR data   Exp. ID 13702
Forward primer (5'-3')
AGGGTTGCTGCTGCAGCTGCTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCACCAGCAGCAGCTGCTGCTTC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 200
Approximate temperature
55°C
  
PCR data   Exp. ID 13703
Forward primer (5'-3')
AGGGTTGCTGCTGCAGCTGCTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCACCAGCAGCAGCTGCTGCTTC
Enzymes
  
Accessions and product sizes
Nicotiana plumbaginifolia TA3354: 200
Approximate temperature
55°C
  
PCR data   Exp. ID 13704
Forward primer (5'-3')
AGGGTTGCTGCTGCAGCTGCTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCACCAGCAGCAGCTGCTGCTTC
Enzymes
  
Accessions and product sizes
Physalis TA1367: 200
Approximate temperature
55°C
  
PCR data   Exp. ID 13705
Forward primer (5'-3')
AGGGTTGCTGCTGCAGCTGCTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCACCAGCAGCAGCTGCTGCTTC
Enzymes
  
Accessions and product sizes
Petunia axillaris TA3309: 200
Approximate temperature
55°C
  
PCR data   Exp. ID 13706
Forward primer (5'-3')
AGGGTTGCTGCTGCAGCTGCTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCACCAGCAGCAGCTGCTGCTTC
Enzymes
  
Accessions and product sizes
Petunia x hybrida TA3311: 200
Approximate temperature
55°C
  
PCR data   Exp. ID 13707
Forward primer (5'-3')
AGGGTTGCTGCTGCAGCTGCTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCACCAGCAGCAGCTGCTGCTTC
Enzymes
  
Accessions and product sizes
Petunia integrifolia TA3312: 200
Approximate temperature
55°C
  
PCR data   Exp. ID 32653
Forward primer (5'-3')
AGGGTTGCTGCTGCAGCTGCTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCACCAGCAGCAGCTGCTGCTTC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 200
Approximate temperature
55°C
  
PCR data   Exp. ID 33198
Forward primer (5'-3')
AGGGTTGCTGCTGCAGCTGCTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCACCAGCAGCAGCTGCTGCTTC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 200
Approximate temperature
55°C
  
PCR data   Exp. ID 33199
Forward primer (5'-3')
AGGGTTGCTGCTGCAGCTGCTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCACCAGCAGCAGCTGCTGCTTC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 200
Approximate temperature
55°C
  
PCR data   Exp. ID 33200
Forward primer (5'-3')
AGGGTTGCTGCTGCAGCTGCTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCACCAGCAGCAGCTGCTGCTTC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 200
Approximate temperature
55°C
  
PCR data   Exp. ID 33201
Forward primer (5'-3')
AGGGTTGCTGCTGCAGCTGCTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCACCAGCAGCAGCTGCTGCTTC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 200
Approximate temperature
55°C
  
PCR data   Exp. ID 11703
Forward primer (5'-3')
AGGGTTGCTGCTGCAGCTGCTTC
Digested band sizes (using HinfI)
Solanum pennellii LA716: 100
Solanum lycopersicum LA925: 150
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCACCAGCAGCAGCTGCTGCTTC
Enzymes
All possible enzymes for pennellii and and lycopersicum: HinfI
  
Accessions and product sizes
Solanum pennellii LA716: 150
Solanum lycopersicum LA925: 150
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA
Forward amplicon sequence for S. hirtum 130005 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, plain text
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text
Forward amplicon sequence for S. quitoense SE plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense SE plant #1, plain text

Genomic location of C2_At5g12370  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8665 marker 8665
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)