SGN Marker C2_At5g13420

SGN-M8681
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle300384 (SGN)
123636 (CGN)
---
Capsicum annuumSingleSGN-U198367---
Lycopersicon CombinedSingleSGN-U214334---
Solanum tuberosumMultipleSGN-U244062---
ArabidopsisSingleAt5g13420 on TAIR---
Mapped locations  
Map: Arabidopsis COSII   
Map version
44 (location: 27139)
Chromosome
5
Position
4.30 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII

PCR data   Exp. ID 41710
Forward primer (5'-3')
AATTCCCGCTACTGCTCCATGC
Accessions and product sizes
Solanum pennellii TA56
500
Solanum lycopersicum TA209
500
Approximate temperature
55°C
Reverse primer (5'-3')
AAGATCAAGAGCCTCTGGAGTTCC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  
Other PCR data 
PCR data   Exp. ID 11714
Forward primer (5'-3')
AATTCCCGCTACTGCTCCATGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGATCAAGAGCCTCTGGAGTTCC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 11715
Forward primer (5'-3')
AATTCCCGCTACTGCTCCATGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGATCAAGAGCCTCTGGAGTTCC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 11716
Forward primer (5'-3')
AATTCCCGCTACTGCTCCATGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGATCAAGAGCCTCTGGAGTTCC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 500
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]

Amplicon sequence alignment, FASTA
At5g13420F.cds.txt, plain text
Forward amplicon sequence for S. lycopersicum TA209, AB1 chromatogram - [View]
Forward amplicon sequence for S. lycopersicum TA209, PDF chromatogram
Forward amplicon sequence for S. lycopersicum TA209, plain text
Forward amplicon sequence for S. pennellii TA56, AB1 chromatogram - [View]
Forward amplicon sequence for S. pennellii TA56, PDF chromatogram
Forward amplicon sequence for S. pennellii TA56, plain text

Genomic location of C2_At5g13420  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8681 marker 8681
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)