SGN Marker C2_At5g13640

SGN-M8686
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle302332 (SGN)
121512 (CGN)
---
Capsicum annuumSingleSGN-U202265---
Solanum tuberosumSingleSGN-U255612---
ArabidopsisSingleAt5g13640 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38789)
Chromosome
3
Position
171.00 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39929
Forward primer (5'-3')
TCAGCTGAAGCACGGGATATTGC
Accessions and product sizes
Solanum pennellii TA56
920+1350
Solanum lycopersicum TA209
920+1350
Approximate temperature
55°C
Reverse primer (5'-3')
TGGAACATATCCGTGTCCAGAACACC
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
640+1350
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 27145)
Chromosome
5
Position
4.40 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 11721
Forward primer (5'-3')
TCAGCTGAAGCACGGGATATTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGGAACATATCCGTGTCCAGAACACC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 650
Approximate temperature
55°C
  
PCR data   Exp. ID 11722
Forward primer (5'-3')
TCAGCTGAAGCACGGGATATTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGGAACATATCCGTGTCCAGAACACC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 650
Approximate temperature
55°C
  
PCR data   Exp. ID 11723
Forward primer (5'-3')
TCAGCTGAAGCACGGGATATTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGGAACATATCCGTGTCCAGAACACC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 650
Approximate temperature
55°C
  
PCR data   Exp. ID 13724
Forward primer (5'-3')
TCAGCTGAAGCACGGGATATTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGGAACATATCCGTGTCCAGAACACC
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: 650
Approximate temperature
55°C
  
PCR data   Exp. ID 13725
Forward primer (5'-3')
TCAGCTGAAGCACGGGATATTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGGAACATATCCGTGTCCAGAACACC
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: 650
Approximate temperature
55°C
  
PCR data   Exp. ID 13726
Forward primer (5'-3')
TCAGCTGAAGCACGGGATATTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGGAACATATCCGTGTCCAGAACACC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 650
Approximate temperature
55°C
  
PCR data   Exp. ID 13727
Forward primer (5'-3')
TCAGCTGAAGCACGGGATATTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGGAACATATCCGTGTCCAGAACACC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 650
Approximate temperature
55°C
  
PCR data   Exp. ID 13728
Forward primer (5'-3')
TCAGCTGAAGCACGGGATATTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGGAACATATCCGTGTCCAGAACACC
Enzymes
  
Accessions and product sizes
Physalis TA1367: 650
Approximate temperature
55°C
  
PCR data   Exp. ID 13729
Forward primer (5'-3')
TCAGCTGAAGCACGGGATATTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGGAACATATCCGTGTCCAGAACACC
Enzymes
  
Accessions and product sizes
Petunia axillaris TA3309: 650
Approximate temperature
55°C
  
PCR data   Exp. ID 13730
Forward primer (5'-3')
TCAGCTGAAGCACGGGATATTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGGAACATATCCGTGTCCAGAACACC
Enzymes
  
Accessions and product sizes
Petunia x hybrida TA3311: 650
Approximate temperature
55°C
  
PCR data   Exp. ID 33211
Forward primer (5'-3')
TCAGCTGAAGCACGGGATATTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGGAACATATCCGTGTCCAGAACACC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 650
Approximate temperature
55°C
  
PCR data   Exp. ID 33212
Forward primer (5'-3')
TCAGCTGAAGCACGGGATATTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGGAACATATCCGTGTCCAGAACACC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 650
Approximate temperature
55°C
  
PCR data   Exp. ID 11724
Forward primer (5'-3')
TCAGCTGAAGCACGGGATATTGC
Digested band sizes (using TaqI)
Solanum pennellii LA716: 420
Solanum lycopersicum LA925: 550
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGGAACATATCCGTGTCCAGAACACC
Enzymes
All possible enzymes for pennellii and and lycopersicum: TaqI
  
Accessions and product sizes
Solanum pennellii LA716: 650
Solanum lycopersicum LA925: 650
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA
Forward amplicon sequence for S. hirtum 130005 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, plain text
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text
Forward amplicon sequence for S. quitoense SE plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense SE plant #1, plain text

Genomic location of C2_At5g13640  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8686 marker 8686
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)