SGN Marker C2_At5g14320

SGN-M8699
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle302290 (SGN)
120953 (CGN)
---
Capsicum annuumSingleSGN-U203153---
Lycopersicon CombinedSingleSGN-U214958---
Solanum tuberosumSingleSGN-U246252---
ArabidopsisSingleAt5g14320 on TAIR---
Mapped locations  
Map: Tobacco N. acuminata   
Map version
89 (location: 46525)
Chromosome
12
Position
57.90 cM
Confidence
F(LOD3)
Protocol
CAPS


Tobacco N. acuminata

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38792)
Chromosome
5
Position
10.00 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39931
Forward primer (5'-3')
TTCTCTTTCCCTTATCTGCAACAC
Accessions and product sizes
Solanum pennellii TA56
580
Solanum lycopersicum TA209
580
Approximate temperature
55°C
Reverse primer (5'-3')
TTTGGAACTTCCACTCCTCCCAC
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
175+375
Solanum lycopersicum TA209
250+300
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 27158)
Chromosome
5
Position
4.62 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 11737
Forward primer (5'-3')
TTCTCTTTCCCTTATCTGCAACAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTTGGAACTTCCACTCCTCCCAC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 580
Approximate temperature
55°C
  
PCR data   Exp. ID 11738
Forward primer (5'-3')
TTCTCTTTCCCTTATCTGCAACAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTTGGAACTTCCACTCCTCCCAC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 580
Approximate temperature
55°C
  
PCR data   Exp. ID 11739
Forward primer (5'-3')
TTCTCTTTCCCTTATCTGCAACAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTTGGAACTTCCACTCCTCCCAC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 580
Approximate temperature
55°C
  
PCR data   Exp. ID 11740
Forward primer (5'-3')
TTCTCTTTCCCTTATCTGCAACAC
Digested band sizes (using TaqI)
Solanum lycopersicum LA925: 250+300
Solanum pennellii LA716: 175+375
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTTGGAACTTCCACTCCTCCCAC
Enzymes
All possible enzymes for pennellii and and lycopersicum: TaqI
  
Accessions and product sizes
Solanum pennellii LA716: 580
Solanum lycopersicum LA925: 580
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]

Forward amplicon sequence for S. lycopersicum TA209, AB1 chromatogram - [View]
Forward amplicon sequence for S. lycopersicum TA209, plain text
Forward amplicon sequence for S. pennellii TA56, AB1 chromatogram - [View]
Forward amplicon sequence for S. pennellii TA56, plain text
Forward amplicon sequence for S. lycopersicum TA209, AB1 chromatogram - [View]
Forward amplicon sequence for S. lycopersicum TA209, plain text
Forward amplicon sequence for S. pennellii TA56, AB1 chromatogram - [View]
Forward amplicon sequence for S. pennellii TA56, plain text
Forward amplicon sequence for S. betaceum 6002061 plant #4, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4, plain text
Forward amplicon sequence for S. uniloba 6002078 plant #6, AB1 chromatogram - [View]
Forward amplicon sequence for S. uniloba 6002078 plant #6, plain text

Genomic location of C2_At5g14320  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8699 marker 8699
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)