SGN Marker C2_At5g14520

SGN-M8701
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle304670 (SGN)
119979 (CGN)
---
Lycopersicon CombinedSingleSGN-U217291---
Solanum tuberosumSingleSGN-U245856---
ArabidopsisSingleAt5g14520 on TAIR---
Mapped locations  
Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46754)
Chromosome
5
Position
93.90 cM
Confidence
F(LOD3)
Protocol
CAPS


Tobacco N. tomentosiformis

Map: Tobacco N. acuminata   
Map version
89 (location: 46526)
Chromosome
5
Position
73.00 cM
Confidence
F(LOD3)
Protocol
CAPS


Tobacco N. acuminata

Map: Pepper-COSII   
Map version
58 (location: 41515)
Chromosome
7
Position
55.60 cM
Confidence
F(LOD3)
Protocol
CAPS


Pepper-COSII

PCR data   Exp. ID 43491
Forward primer (5'-3')
ACACAGGGCCACAAATTCCTTTC
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
TGCCTGTAGACGCTTGATGGTCTC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38793)
Chromosome
7
Position
38.30 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39932
Forward primer (5'-3')
ACACAGGGCCACAAATTCCTTTC
Accessions and product sizes
Solanum lycopersicum TA209
850
Solanum pennellii TA56
850
Approximate temperature
55°C
Reverse primer (5'-3')
TGCCTGTAGACGCTTGATGGTCTC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 27160)
Chromosome
5
Position
4.68 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 11741
Forward primer (5'-3')
ATCCCTCCACCACACTTGTCACC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCTTTTTTCAATTCATCATGATATTGC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 11742
Forward primer (5'-3')
ATCCCTCCACCACACTTGTCACC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCTTTTTTCAATTCATCATGATATTGC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 11743
Forward primer (5'-3')
ATCCCTCCACCACACTTGTCACC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCTTTTTTCAATTCATCATGATATTGC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 500
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Amplicon sequence alignment, FASTA
At5g14520F.cds.txt, plain text
Forward amplicon sequence for S. pimpinellifolium LA1589, AB1 chromatogram - [View]
Forward amplicon sequence for S. pimpinellifolium LA1589, plain text
Forward amplicon sequence for S. lycopersicum TA209, AB1 chromatogram - [View]
Forward amplicon sequence for S. lycopersicum TA209, plain text
Forward amplicon sequence for S. pennellii TA56, AB1 chromatogram - [View]
Forward amplicon sequence for S. pennellii TA56, plain text

Genomic location of C2_At5g14520  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8701 marker 8701
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)