SGN Marker C2_At5g15410

SGN-M8711
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle300629 (SGN)
124447 (CGN)
---
Capsicum annuumSingleSGN-U201774---
ArabidopsisSingleAt5g15410 on TAIR---
Mapped locations  
Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46755)
Chromosome
2
Position
7.30 cM
Confidence
CF(LOD3)
Protocol
dCAPS


Tobacco N. tomentosiformis

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38795)
Chromosome
2
Position
106.50 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39933
Forward primer (5'-3')
ACCATCGCAATTAACACAAAGAGTTCG
Accessions and product sizes
Solanum lycopersicum TA209
1125
Solanum pennellii TA56
1125
Approximate temperature
55°C
Reverse primer (5'-3')
ATCAGATCATCCGGACTATGGAACAG
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
1125
Solanum lycopersicum TA209
600
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 27169)
Chromosome
5
Position
5.01 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At5g15410  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8711 marker 8711
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)