SGN Marker C2_At5g17170

SGN-M8729
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
Capsicum annuumSingleSGN-U204194---
Lycopersicon CombinedSingleSGN-U217099---
Solanum tuberosumSingleSGN-U256268---
ArabidopsisSingleAt5g17170 on TAIR---
Mapped locations  
Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46757)
Chromosome
3
Position
48.40 cM
Confidence
I(LOD2)
Protocol
CAPS


Tobacco N. tomentosiformis

Map: Eggplant-COSII   
Map version
63 (location: 42251)
Chromosome
3
Position
72.80 cM
Confidence
F(LOD3)
Protocol
dCAPS


Eggplant-COSII

PCR data   Exp. ID 43819
Forward primer (5'-3')
CCTTAGGTCCAAAGCAAGGCGGTC
Accessions and product sizes
Approximate temperature
58°C
Reverse primer (5'-3')
TTGCAGCATTACCGCCATTATCTA
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Pepper-COSII   
Map version
58 (location: 41518)
Chromosome
3
Position
91.90 cM
Confidence
F(LOD3)
Protocol
dCAPS


Pepper-COSII

PCR data   Exp. ID 43494
Forward primer (5'-3')
TTCAAGGGCTATCATTACAAGAGGC
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
CTTGCGAGAAATTCTCTAATAAGTGGT
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38798)
Chromosome
3
Position
72.90 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39936
Forward primer (5'-3')
TTCAAGGGCTATCATTACAAGAGGC
Accessions and product sizes
Approximate temperature
Unknown
Reverse primer (5'-3')
TTGCAGCATTACCGCCATTATCTA
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 27188)
Chromosome
5
Position
5.65 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At5g17170  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8729 marker 8729
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)