SGN Marker C2_At5g19910

SGN-M8771
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle304439 (SGN)
124036 (CGN)
---
Lycopersicon CombinedSingleSGN-U238679---
ArabidopsisSingleAt5g19910 on TAIR---
Mapped locations  
Map: Arabidopsis COSII   
Map version
44 (location: 27231)
Chromosome
5
Position
6.73 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII

PCR data   Exp. ID 41738
Forward primer (5'-3')
TCTTTCTCGAGCTTCTCCAAAATCC
Accessions and product sizes
Solanum pennellii TA56
350
Solanum lycopersicum TA209
350
Approximate temperature
55°C
Reverse primer (5'-3')
TCCGTTTTAGCAAGACCAGATCCAG
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
175
Solanum pennellii TA56
350
Mg+2 concentration
1.5mM
   Enzymes
  
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At5g19910  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8771 marker 8771
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)