SGN Marker C2_At5g20180

SGN-M8779
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle301390 (SGN)
125300 (CGN)
---
Capsicum annuumSingleSGN-U198242---
Lycopersicon CombinedSingleSGN-U220271---
Solanum tuberosumSingleSGN-U250312---
ArabidopsisSingleAt5g20180 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38807)
Chromosome
7
Position
6.00 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39940
Forward primer (5'-3')
TGCTATGTACATCTAATCCCAAGCAC
Accessions and product sizes
Solanum pennellii TA56
1300
Solanum lycopersicum TA209
1300
Approximate temperature
55°C
Reverse primer (5'-3')
AGCTATCCCCCTTTTCCACCAAG
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
430+520
Solanum lycopersicum TA209
1300
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 27239)
Chromosome
5
Position
6.81 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 11767
Forward primer (5'-3')
TGCTATGTACATCTAATCCCAAGCAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCTATCCCCCTTTTCCACCAAG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1300
Approximate temperature
55°C
  
PCR data   Exp. ID 11768
Forward primer (5'-3')
TGCTATGTACATCTAATCCCAAGCAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCTATCCCCCTTTTCCACCAAG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1300
Approximate temperature
55°C
  
PCR data   Exp. ID 11769
Forward primer (5'-3')
TGCTATGTACATCTAATCCCAAGCAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCTATCCCCCTTTTCCACCAAG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 1300
Approximate temperature
55°C
  
PCR data   Exp. ID 13749
Forward primer (5'-3')
TGCTATGTACATCTAATCCCAAGCAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCTATCCCCCTTTTCCACCAAG
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: 1300
Approximate temperature
55°C
  
PCR data   Exp. ID 13750
Forward primer (5'-3')
TGCTATGTACATCTAATCCCAAGCAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCTATCCCCCTTTTCCACCAAG
Enzymes
  
Accessions and product sizes
Solanum melongena TA2986: 1050
Approximate temperature
55°C
  
PCR data   Exp. ID 13751
Forward primer (5'-3')
TGCTATGTACATCTAATCCCAAGCAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCTATCCCCCTTTTCCACCAAG
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: 1300
Approximate temperature
55°C
  
PCR data   Exp. ID 13752
Forward primer (5'-3')
TGCTATGTACATCTAATCCCAAGCAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCTATCCCCCTTTTCCACCAAG
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 13753
Forward primer (5'-3')
TGCTATGTACATCTAATCCCAAGCAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCTATCCCCCTTTTCCACCAAG
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 13754
Forward primer (5'-3')
TGCTATGTACATCTAATCCCAAGCAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCTATCCCCCTTTTCCACCAAG
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 1050
Approximate temperature
55°C
  
PCR data   Exp. ID 13755
Forward primer (5'-3')
TGCTATGTACATCTAATCCCAAGCAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCTATCCCCCTTTTCCACCAAG
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 1050
Approximate temperature
55°C
  
PCR data   Exp. ID 13756
Forward primer (5'-3')
TGCTATGTACATCTAATCCCAAGCAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCTATCCCCCTTTTCCACCAAG
Enzymes
  
Accessions and product sizes
Physalis TA1367: Multiple
Approximate temperature
55°C
  
PCR data   Exp. ID 13757
Forward primer (5'-3')
TGCTATGTACATCTAATCCCAAGCAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCTATCCCCCTTTTCCACCAAG
Enzymes
  
Accessions and product sizes
Petunia axillaris TA3309: 1300
Approximate temperature
55°C
  
PCR data   Exp. ID 13758
Forward primer (5'-3')
TGCTATGTACATCTAATCCCAAGCAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCTATCCCCCTTTTCCACCAAG
Enzymes
  
Accessions and product sizes
Petunia axillaris subsp. parodii TA3310: Multiple
Approximate temperature
55°C
  
PCR data   Exp. ID 13759
Forward primer (5'-3')
TGCTATGTACATCTAATCCCAAGCAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCTATCCCCCTTTTCCACCAAG
Enzymes
  
Accessions and product sizes
Petunia x hybrida TA3311: 1350
Approximate temperature
55°C
  
PCR data   Exp. ID 13760
Forward primer (5'-3')
TGCTATGTACATCTAATCCCAAGCAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCTATCCCCCTTTTCCACCAAG
Enzymes
  
Accessions and product sizes
Petunia integrifolia TA3312: 1300
Approximate temperature
55°C
  
PCR data   Exp. ID 33220
Forward primer (5'-3')
TGCTATGTACATCTAATCCCAAGCAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCTATCCCCCTTTTCCACCAAG
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 33221
Forward primer (5'-3')
TGCTATGTACATCTAATCCCAAGCAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCTATCCCCCTTTTCCACCAAG
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 33222
Forward primer (5'-3')
TGCTATGTACATCTAATCCCAAGCAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCTATCCCCCTTTTCCACCAAG
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 1050
Approximate temperature
55°C
  
PCR data   Exp. ID 33223
Forward primer (5'-3')
TGCTATGTACATCTAATCCCAAGCAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCTATCCCCCTTTTCCACCAAG
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 1050
Approximate temperature
55°C
  
PCR data   Exp. ID 11770
Forward primer (5'-3')
TGCTATGTACATCTAATCCCAAGCAC
Digested band sizes (using HinfI)
Solanum lycopersicum LA925: 1300
Solanum pennellii LA716: 430+520
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCTATCCCCCTTTTCCACCAAG
Enzymes
All possible enzymes for pennellii and and lycopersicum: AluI, DraI, HinfI
All possible enzymes for lycopersicum and pimpinellifolium: AluI, TaqI
  
Accessions and product sizes
Solanum lycopersicum LA925: 1300
Solanum pennellii LA716: 1300
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, plain text
Forward amplicon sequence for S. hirtum 120061 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120061 plant #1, plain text
Forward amplicon sequence for S. quitoense var quitoense 120101 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense var quitoense 120101 plant #1, plain text
Forward amplicon sequence for S. quitoense var septentrionale 120103 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense var septentrionale 120103 plant #3, plain text
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text
Forward amplicon sequence for S. quitoense var septentrionale 120039 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense var septentrionale 120039 plant #1, plain text
Forward amplicon sequence for S. quitoense var quitoense 120044 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense var quitoense 120044 plant #1, plain text
Forward amplicon sequence for S. quitoense var quitoense 120052 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense var quitoense 120052 plant #3, plain text
Forward amplicon sequence for S. hirtum 120060 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120060 plant #1, plain text
Forward amplicon sequence for S. hirtum 120062 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #1, plain text
Forward amplicon sequence for S. hirtum 120071 plant #2, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120071 plant #2, plain text
Forward amplicon sequence for S. quitoense SE plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense SE plant #1, plain text


BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, plain text
Forward amplicon sequence for S. hirtum 120061 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120061 plant #1, plain text
Forward amplicon sequence for S. quitoense var quitoense 120101 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense var quitoense 120101 plant #1, plain text
Forward amplicon sequence for S. quitoense var septentrionale 120103 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense var septentrionale 120103 plant #3, plain text
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text
Forward amplicon sequence for S. quitoense var septentrionale 120039 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense var septentrionale 120039 plant #1, plain text
Forward amplicon sequence for S. quitoense var quitoense 120044 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense var quitoense 120044 plant #1, plain text
Forward amplicon sequence for S. quitoense var quitoense 120052 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense var quitoense 120052 plant #3, plain text
Forward amplicon sequence for S. hirtum 120060 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120060 plant #1, plain text
Forward amplicon sequence for S. hirtum 120062 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #1, plain text
Forward amplicon sequence for S. hirtum 120071 plant #2, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120071 plant #2, plain text
Forward amplicon sequence for S. quitoense SE plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense SE plant #1, plain text

Genomic location of C2_At5g20180  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8779 marker 8779
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)