SGN Marker C2_At5g20520

SGN-M8782
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle308094 (SGN)
130635 (CGN)
---
Capsicum annuumSingleSGN-U203982---
Lycopersicon CombinedMultipleSGN-U217973---
Solanum tuberosumSingleSGN-U249811---
ArabidopsisSingleAt5g20520 on TAIR---
Mapped locations  
Map: Pepper-COSII   
Map version
58 (location: 41522)
Chromosome
7
Position
52.10 cM
Confidence
F(LOD3)
Protocol
CAPS


Pepper-COSII

PCR data   Exp. ID 43498
Forward primer (5'-3')
TCTTACCAAAAACAATCCTGACAAGG
Accessions and product sizes
Approximate temperature
60°C
Reverse primer (5'-3')
AGTATTCTCCAAAATGAGCCCAGC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38809)
Chromosome
7
Position
22.30 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 41741
Forward primer (5'-3')
TAGTTCAGAGGACCGATATTGACACATC
Accessions and product sizes
Approximate temperature
Unknown
Reverse primer (5'-3')
AAAGTATTCTCCAAAATGAGCCCAGC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 27242)
Chromosome
5
Position
6.94 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 11775
Forward primer (5'-3')
TCTTACCAAAAACAATCCTGACAAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGTATTCTCCAAAATGAGCCCAGC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1400
Approximate temperature
55°C
  
PCR data   Exp. ID 11776
Forward primer (5'-3')
TCTTACCAAAAACAATCCTGACAAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGTATTCTCCAAAATGAGCCCAGC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1400
Approximate temperature
55°C
  
PCR data   Exp. ID 11777
Forward primer (5'-3')
TCTTACCAAAAACAATCCTGACAAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGTATTCTCCAAAATGAGCCCAGC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 1400
Approximate temperature
55°C
  
PCR data   Exp. ID 13761
Forward primer (5'-3')
TCTTACCAAAAACAATCCTGACAAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGTATTCTCCAAAATGAGCCCAGC
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: 1400
Approximate temperature
55°C
  
PCR data   Exp. ID 13762
Forward primer (5'-3')
TCTTACCAAAAACAATCCTGACAAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGTATTCTCCAAAATGAGCCCAGC
Enzymes
  
Accessions and product sizes
Solanum melongena TA2986: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 13763
Forward primer (5'-3')
TCTTACCAAAAACAATCCTGACAAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGTATTCTCCAAAATGAGCCCAGC
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: 1350
Approximate temperature
55°C
  
PCR data   Exp. ID 13764
Forward primer (5'-3')
TCTTACCAAAAACAATCCTGACAAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGTATTCTCCAAAATGAGCCCAGC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 13765
Forward primer (5'-3')
TCTTACCAAAAACAATCCTGACAAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGTATTCTCCAAAATGAGCCCAGC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 13766
Forward primer (5'-3')
TCTTACCAAAAACAATCCTGACAAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGTATTCTCCAAAATGAGCCCAGC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 1350
Approximate temperature
55°C
  
PCR data   Exp. ID 13767
Forward primer (5'-3')
TCTTACCAAAAACAATCCTGACAAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGTATTCTCCAAAATGAGCCCAGC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 1300
Approximate temperature
55°C
  
PCR data   Exp. ID 13768
Forward primer (5'-3')
TCTTACCAAAAACAATCCTGACAAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGTATTCTCCAAAATGAGCCCAGC
Enzymes
  
Accessions and product sizes
Nicotiana plumbaginifolia TA3354: 1300
Approximate temperature
55°C
  
PCR data   Exp. ID 13769
Forward primer (5'-3')
TCTTACCAAAAACAATCCTGACAAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGTATTCTCCAAAATGAGCCCAGC
Enzymes
  
Accessions and product sizes
Physalis TA1367: 1400
Approximate temperature
55°C
  
PCR data   Exp. ID 13770
Forward primer (5'-3')
TCTTACCAAAAACAATCCTGACAAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGTATTCTCCAAAATGAGCCCAGC
Enzymes
  
Accessions and product sizes
Petunia axillaris TA3309: 1550
Approximate temperature
55°C
  
PCR data   Exp. ID 13771
Forward primer (5'-3')
TCTTACCAAAAACAATCCTGACAAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGTATTCTCCAAAATGAGCCCAGC
Enzymes
  
Accessions and product sizes
Petunia axillaris subsp. parodii TA3310: 1350+1600
Approximate temperature
55°C
  
PCR data   Exp. ID 13772
Forward primer (5'-3')
TCTTACCAAAAACAATCCTGACAAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGTATTCTCCAAAATGAGCCCAGC
Enzymes
  
Accessions and product sizes
Petunia x hybrida TA3311: 1600
Approximate temperature
55°C
  
PCR data   Exp. ID 13773
Forward primer (5'-3')
TCTTACCAAAAACAATCCTGACAAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGTATTCTCCAAAATGAGCCCAGC
Enzymes
  
Accessions and product sizes
Coffea canephora BP409: 1100
Approximate temperature
55°C
  
PCR data   Exp. ID 33224
Forward primer (5'-3')
TCTTACCAAAAACAATCCTGACAAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGTATTCTCCAAAATGAGCCCAGC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 33225
Forward primer (5'-3')
TCTTACCAAAAACAATCCTGACAAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGTATTCTCCAAAATGAGCCCAGC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 33226
Forward primer (5'-3')
TCTTACCAAAAACAATCCTGACAAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGTATTCTCCAAAATGAGCCCAGC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 1350
Approximate temperature
55°C
  
PCR data   Exp. ID 33227
Forward primer (5'-3')
TCTTACCAAAAACAATCCTGACAAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGTATTCTCCAAAATGAGCCCAGC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 1300
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]

Amplicon sequence alignment, FASTA
At5g20520F.cds.txt, plain text
Forward amplicon sequence for S. lycopersicum TA209, AB1 chromatogram - [View]
Forward amplicon sequence for S. lycopersicum TA209, PDF chromatogram
Forward amplicon sequence for S. lycopersicum TA209, plain text
Forward amplicon sequence for S. pennellii TA56, AB1 chromatogram - [View]
Forward amplicon sequence for S. pennellii TA56, PDF chromatogram
Forward amplicon sequence for S. pennellii TA56, plain text

Genomic location of C2_At5g20520  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8782 marker 8782
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)