SGN Marker C2_At5g21170

SGN-M8790
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle311829 (SGN)
128124 (CGN)
---
Capsicum annuumSingleSGN-U204941---
Lycopersicon CombinedSingleSGN-U220010---
Solanum tuberosumMultipleSGN-U244679---
ArabidopsisSingleAt5g21170 on TAIR---
Mapped locations  
Map: Eggplant-RAD 2012   
Map version
174 (location: 132193)
Chromosome
5
Position
101.40 cM
Confidence
uncalculated
Protocol
CAPS


Eggplant-RAD 2012

Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46759)
Chromosome
12
Position
71.10 cM
Confidence
I(LOD2)
Protocol
dCAPS


Tobacco N. tomentosiformis

Map: Tobacco N. acuminata   
Map version
89 (location: 46529)
Chromosome
12
Position
5.00 cM
Confidence
I(LOD2)
Protocol
dCAPS


Tobacco N. acuminata

Map: Eggplant-COSII   
Map version
63 (location: 42252)
Chromosome
5
Position
117.60 cM
Confidence
F(LOD3)
Protocol
CAPS


Eggplant-COSII

PCR data   Exp. ID 43820
Forward primer (5'-3')
TCCTTCCATCGGGTATATATCATTACAA
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
ACTGCCACTGGCTCCTTTTCAAAATC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38813)
Chromosome
12
Position
120.00 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 41744
Forward primer (5'-3')
TCCTTCCATCGGGTATATATCATTACAA
Accessions and product sizes
Approximate temperature
Unknown
Reverse primer (5'-3')
ACTGCCACTGGCTCCTTTTCAAAATC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 27251)
Chromosome
5
Position
7.21 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At5g21170  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8790 marker 8790
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)