SGN Marker C2_At5g22010

SGN-M8792
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle308003 (SGN)
127613 (CGN)
---
Capsicum annuumSingleSGN-U199709---
ArabidopsisSingleAt5g22010 on TAIR---
Mapped locations  
Map: Pepper-COSII   
Map version
58 (location: 41523)
Chromosome
7
Position
7.00 cM
Confidence
I(LOD2)
Protocol
CAPS


Pepper-COSII

PCR data   Exp. ID 43499
Forward primer (5'-3')
TTGCATGTTCACCTACTCGCATCTCG
Accessions and product sizes
Approximate temperature
65°C
Reverse primer (5'-3')
TCTTTCCAAGAAGAGTAAAGTAGTCCA
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38814)
Chromosome
7
Position
2.00 cM
Confidence
CF(LOD3)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 41745
Forward primer (5'-3')
TTGCATGTTCACCTACTCGCATCTCG
Accessions and product sizes
Approximate temperature
Unknown
Reverse primer (5'-3')
TCTTTCCAAGAAGAGTAAAGTAGTCCA
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 27253)
Chromosome
5
Position
7.28 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At5g22010  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8792 marker 8792
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)