SGN Marker C2_At5g22350

SGN-M8797
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle303548 (SGN)
121145 (CGN)
---
Lycopersicon CombinedSingleSGN-U216816---
Solanum tuberosumSingleSGN-U248674---
ArabidopsisSingleAt5g22350 on TAIR---
Mapped locations  
Map: Arabidopsis COSII   
Map version
44 (location: 27258)
Chromosome
5
Position
7.40 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII

PCR data   Exp. ID 41746
Forward primer (5'-3')
ATGGGGCATCTGGCTTGGGC
Accessions and product sizes
Solanum lycopersicum TA209
530
Solanum pennellii TA56
530
Approximate temperature
55°C
Reverse primer (5'-3')
AGCGGAGGGTAACTCCAGCTTTC
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
220
Solanum lycopersicum TA209
380
Mg+2 concentration
1.5mM
   Enzymes
  
Other PCR data 
PCR data   Exp. ID 11789
Forward primer (5'-3')
ATGGGGCATCTGGCTTGGGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCGGAGGGTAACTCCAGCTTTC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1500
Approximate temperature
55°C
  
PCR data   Exp. ID 11790
Forward primer (5'-3')
ATGGGGCATCTGGCTTGGGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCGGAGGGTAACTCCAGCTTTC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1500
Approximate temperature
55°C
  
PCR data   Exp. ID 11791
Forward primer (5'-3')
ATGGGGCATCTGGCTTGGGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCGGAGGGTAACTCCAGCTTTC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 1500
Approximate temperature
55°C
  
PCR data   Exp. ID 13782
Forward primer (5'-3')
ATGGGGCATCTGGCTTGGGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCGGAGGGTAACTCCAGCTTTC
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: 1300
Approximate temperature
55°C
  
PCR data   Exp. ID 13783
Forward primer (5'-3')
ATGGGGCATCTGGCTTGGGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCGGAGGGTAACTCCAGCTTTC
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: 1600
Approximate temperature
55°C
  
PCR data   Exp. ID 13784
Forward primer (5'-3')
ATGGGGCATCTGGCTTGGGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCGGAGGGTAACTCCAGCTTTC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 13785
Forward primer (5'-3')
ATGGGGCATCTGGCTTGGGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCGGAGGGTAACTCCAGCTTTC
Enzymes
  
Accessions and product sizes
Nicotiana plumbaginifolia TA3354: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 13786
Forward primer (5'-3')
ATGGGGCATCTGGCTTGGGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCGGAGGGTAACTCCAGCTTTC
Enzymes
  
Accessions and product sizes
Physalis TA1367: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 13787
Forward primer (5'-3')
ATGGGGCATCTGGCTTGGGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCGGAGGGTAACTCCAGCTTTC
Enzymes
  
Accessions and product sizes
Petunia axillaris TA3309: 650
Approximate temperature
55°C
  
PCR data   Exp. ID 13788
Forward primer (5'-3')
ATGGGGCATCTGGCTTGGGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCGGAGGGTAACTCCAGCTTTC
Enzymes
  
Accessions and product sizes
Petunia x hybrida TA3311: 650
Approximate temperature
55°C
  
PCR data   Exp. ID 13789
Forward primer (5'-3')
ATGGGGCATCTGGCTTGGGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCGGAGGGTAACTCCAGCTTTC
Enzymes
  
Accessions and product sizes
Petunia integrifolia TA3312: 650
Approximate temperature
55°C
  
PCR data   Exp. ID 33232
Forward primer (5'-3')
ATGGGGCATCTGGCTTGGGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCGGAGGGTAACTCCAGCTTTC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 1200
Approximate temperature
55°C
  
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At5g22350  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8797 marker 8797
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)