SGN Marker C2_At5g22620

SGN-M8799
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle301944 (SGN)
122739 (CGN)
---
Capsicum annuumSingleSGN-U205225---
Lycopersicon CombinedSingleSGN-U228005---
ArabidopsisSingleAt5g22620 on TAIR---
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49294)
Chromosome
6
Position
42.49 MB
Confidence
uncalculated
Protocol
CAPS


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47235)
Chromosome
6
Position
75.71 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46760)
Chromosome
6
Position
37.80 cM
Confidence
F(LOD3)
Protocol
CAPS


Tobacco N. tomentosiformis

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38815)
Chromosome
6
Position
74.00 cM
Confidence
CF(LOD3)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39944
Forward primer (5'-3')
TCAAGAAGCTGCTGACTGCCTTGG
Accessions and product sizes
Solanum pennellii TA56
1350
Solanum lycopersicum TA209
1350
Approximate temperature
55°C
Reverse primer (5'-3')
TCCCTGAGGGTCCATCAGGAAAATC
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
800
Solanum lycopersicum TA209
1350
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 27260)
Chromosome
5
Position
7.52 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text
Forward amplicon sequence for S. betaceum 6002061 plant #4, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4, plain text
Forward amplicon sequence for S. uniloba 6002078 plant #6, AB1 chromatogram - [View]
Forward amplicon sequence for S. uniloba 6002078 plant #6, plain text

Genomic location of C2_At5g22620  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8799 marker 8799
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)