Notice: Due to a server issue, SGN was unavailable earlier today. We apologize for any inconvenience.

SGN Marker TG63

SGN-M88

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
2000
Vector
pUC
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
CAGTTGACACAAGTAGTATAGTGGTTTCCCAATGTGTGACAAATGATAATTGCGTGGACCCAAATGGGTTGCCTGTGTTTGACAAGAACT
TTGCTAACCCACATATTCCACTTTTCAAACATAGGCAACCTTGCACAAGTTTTAAGTTGTGTGAGGCATTTTGATTCGCACAAACTCGAT
TTGTCATAACATAAAGAGACACACATAACTTGTGTCAGTTGTGTGAGGTACAAAAGTATTTTTTTTCTCGATCTGCATCAACTGGATATT
CCAAAGTAGCCCAGAGTCCCCCTTCCTATTGCACAACATTCATTTTGCTCACTTTTCCAGACTTCGGTGAACAATTCACCATTTACTTGA
ACAGTCTTTCCCCATAGTCGACCATAAAGACAACAACAACATTGTCCATACTTATACTTGCCTTTGACCCTCCCTATATCACATATTTCT
AAGAGCACTCTAGGTAAATCGGATCTGCTATATTTTTAATAATCAACAGGAAC
Reverse sequence
GAGAAGGGAAATGAAGAACACTGTTGCCGAGATGTTGAATTTGCGTAAGATCAGGTAGTGAAGGACAGAAGTCTACTCTTATAATGTTAT
CTGTTGTTTTTGTTTCTTCACATTTACCTACTATATGGGGGTTGGGGTCTGGCTTTCACAAACAACAGATTGCTTGCCTTTGGTATTTGA
GTTGGTGTAGTATTGTTTGCTTGGTTGTTGTATAAGTTGCTAGTTATTCTTTGTTAGTCAAAGATAATGTAAAATGATGCGGCTGATGTT
TGACTGTGCAATTGATTTGCTATCAGTCAAGCCAAAGTTGCACTAAATGTTTGGCAGCCAGAGATTGCCCGGGGTAAGCAGAAGCAGATG
GTTGAGCAGTGCAATGTACCTATTGATAACCGTATCCATGCCATTGAGATGGAGCTCAAGCTATGCATACAACAAATTCAAGGGTTAGAG
AAGGCCCTTGTAAGTTCACATCTGTCTTGTGGAGAATAATGAGGCATTCATCTAGTAATTTATGAACTGCATTATG
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1655679e-80149 (29.6% of RFLP seq)+
SGN-U1518052.8e-1846 (8.7% of RFLP seq)-
SGN-U1518052.6e-86168 (31.9% of RFLP seq)-
Mapped locations  
Map: Solanum michoacanum 2011   
Map version
155 (location: 109261)
Chromosome
10
Position
50.55 cM
Confidence
uncalculated
Protocol
CAPS


Solanum michoacanum 2011

Map: Tomato-EXPIMP 2009   
Map version
126 (location: 53579)
Chromosome
10
Position
78.89 cM
Confidence
uncalculated
Protocol
RFLP


Tomato-EXPIMP 2009

Map: Potato meta-QTL consensus map   
Map version
107 (location: 53371)
Chromosome
10
Position
64.31 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Late_blight_10 MQTL_2_Late_blight_10
Potato meta-QTL consensus map

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 50418)
Chromosome
10
Position
64.09 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 48350)
Chromosome
10
Position
80.03 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Sun1642 x LA1589   
Map version
85 (location: 43885)
Chromosome
10
Position
92.50 cM
Confidence
uncalculated
Protocol
RFLP


Sun1642 x LA1589

Map: Yellow Stuffer x LA1589   
Map version
83 (location: 43625)
Chromosome
10
Position
88.10 cM
Confidence
uncalculated
Protocol
RFLP


Yellow Stuffer x LA1589

Map: Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589   
Map version
79 (location: 43348)
Chromosome
10
Position
81.30 cM
Confidence
uncalculated
Protocol
RFLP


Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589

Map: Pepper Capsicum   
Map version
65 (location: 42843)
Chromosome
10
Position
66.80 cM
Confidence
uncalculated
Protocol
RFLP


Pepper Capsicum

Map: Eggplant-COSII   
Map version
63 (location: 42499)
Chromosome
10
Position
89.50 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-COSII

Map: Tomato-EXPIMP 2008   
Map version
55 (location: 40823)
Chromosome
10
Position
83.00 cM
Confidence
uncalculated
Protocol
CAPS


Tomato-EXPIMP 2008

PCR data   Exp. ID 36568
Forward primer (5'-3')
CTCGATCTGCATCAACTGGA
Accessions and product sizes
Approximate temperature
Unknown
Reverse primer (5'-3')
ACACTGTTGCCGAGATGTTG
Digested band sizes (using HindIII)
Solanum pennellii TA56
1700
Solanum lycopersicum TA209
1000
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40118)
Chromosome
10
Position
80.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000

Map: Eggplant-LXM 2002   
Map version
29 (location: 8035)
Chromosome
10
Position
73.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-LXM 2002

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8034)
Chromosome
10
Position
84.10 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992

Map: Potato-TXB 1992   
Map version
27 (location: 8040)
Chromosome
10
Position
26.10 cM
Confidence
I(LOD2)
Protocol
RFLP


Potato-TXB 1992

Map: Tomato-EXPIMP 2001   
Map version
26 (location: 8039)
Chromosome
10
Position
103.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPIMP 2001
Overgo hybridization and physical mapping 
TG63 was used as an overgo probe on plate 5 [well A9]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
TGATAATTGCGTGGACCCAAATGG
B sequence
GTCAAACACAGGCAACCCATTTGG
AB sequence
TGATAATTGCGTGGACCCAAATGGGTTGCC
Marker sequence
CAGTTGACACAAGTAGTATAGTGGTTTCCCAATGTGTGACAAATGATAAT
TGCGTGGACCCAAATGGGTTGCCTGTGTTTGACAAGAACTTTGCTAACCC
ACATATTCCACTTTTCAAACATAGGCAACCTTGCACAAGTTTTAAGTTGT
GTGAGGCATTTTGATTCGCACAAACTCGATTTGTCATAACATAAAGAGAC
ACACATAACTTGTGTCAGTTGTGTGAGGTACAAAAGTATTTTTTTTCTCG
ATCTGCATCAACTGGATATTCCAAAGTAGCCCAGAGTCCCCCTTCCTATT
GCACAACATTCATTTTGCTCACTTTTCCAGACTTCGGTGAACAATTCACC
ATTTACTTGAACAGTCTTTCCCCATAGTCGACCATAAAGACAACAACAAC
ATTGTCCATACTTATACTTGCCTTTGACCCTCCCTATATCACATATTTCT
AAGAGCACTCTAGGTAAATCGGATCTGCTATATTTTTAATAATCAACAGG
AAC
Genomic location of TG63  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D88 marker 88
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)