SGN Marker C2_At5g22820

SGN-M8802
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle302553 (SGN)
123467 (CGN)
---
Solanum tuberosumSingleSGN-U255806---
ArabidopsisSingleAt5g22820 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38816)
Chromosome
6
Position
74.80 cM
Confidence
F(LOD3)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 41747
Forward primer (5'-3')
ACCACAGTTGATCCTGCTTATATAATATC
Accessions and product sizes
Approximate temperature
Unknown
Reverse primer (5'-3')
AGCAGAGTCGCCAAAAGCACTTCAAG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 27263)
Chromosome
5
Position
7.63 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At5g22820  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8802 marker 8802
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)