Notice: The FTP site is available again. We apologize for any inconvenience.

SGN Marker C2_At5g23120

SGN-M8810
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
Capsicum annuumSingleSGN-U199573---
Lycopersicon CombinedMultipleSGN-U216498---
Solanum tuberosumSingleSGN-U251304---
ArabidopsisSingleAt5g23120 on TAIR---
Mapped locations  
Map: Arabidopsis COSII   
Map version
44 (location: 27271)
Chromosome
5
Position
7.78 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII

PCR data   Exp. ID 41752
Forward primer (5'-3')
TGAAGACACTCCTCTCTCTGAATGGG
Accessions and product sizes
Solanum lycopersicum TA209
250
Solanum pennellii TA56
250
Approximate temperature
55°C
Reverse primer (5'-3')
AGGCTATGGATCTAGGTACCCAAG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  
Other PCR data 
PCR data   Exp. ID 11802
Forward primer (5'-3')
TGAAGACACTCCTCTCTCTGAATGGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGCTATGGATCTAGGTACCCAAG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1300
Approximate temperature
55°C
  
PCR data   Exp. ID 11803
Forward primer (5'-3')
TGAAGACACTCCTCTCTCTGAATGGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGCTATGGATCTAGGTACCCAAG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1300
Approximate temperature
55°C
  
PCR data   Exp. ID 11804
Forward primer (5'-3')
TGAAGACACTCCTCTCTCTGAATGGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGCTATGGATCTAGGTACCCAAG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 1300
Approximate temperature
55°C
  
PCR data   Exp. ID 13790
Forward primer (5'-3')
TGAAGACACTCCTCTCTCTGAATGGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGCTATGGATCTAGGTACCCAAG
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: 1100
Approximate temperature
55°C
  
PCR data   Exp. ID 13791
Forward primer (5'-3')
TGAAGACACTCCTCTCTCTGAATGGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGCTATGGATCTAGGTACCCAAG
Enzymes
  
Accessions and product sizes
Solanum melongena TA2986: 1400
Approximate temperature
55°C
  
PCR data   Exp. ID 13792
Forward primer (5'-3')
TGAAGACACTCCTCTCTCTGAATGGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGCTATGGATCTAGGTACCCAAG
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: 1850
Approximate temperature
55°C
  
PCR data   Exp. ID 13793
Forward primer (5'-3')
TGAAGACACTCCTCTCTCTGAATGGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGCTATGGATCTAGGTACCCAAG
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: Multiple
Approximate temperature
55°C
  
PCR data   Exp. ID 13794
Forward primer (5'-3')
TGAAGACACTCCTCTCTCTGAATGGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGCTATGGATCTAGGTACCCAAG
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 1100
Approximate temperature
55°C
  
PCR data   Exp. ID 13795
Forward primer (5'-3')
TGAAGACACTCCTCTCTCTGAATGGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGCTATGGATCTAGGTACCCAAG
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 13796
Forward primer (5'-3')
TGAAGACACTCCTCTCTCTGAATGGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGCTATGGATCTAGGTACCCAAG
Enzymes
  
Accessions and product sizes
Petunia axillaris TA3309: 1250
Approximate temperature
55°C
  
PCR data   Exp. ID 13797
Forward primer (5'-3')
TGAAGACACTCCTCTCTCTGAATGGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGCTATGGATCTAGGTACCCAAG
Enzymes
  
Accessions and product sizes
Petunia axillaris subsp. parodii TA3310: 1100
Approximate temperature
55°C
  
PCR data   Exp. ID 33233
Forward primer (5'-3')
TGAAGACACTCCTCTCTCTGAATGGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGCTATGGATCTAGGTACCCAAG
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: Multiple
Approximate temperature
55°C
  
PCR data   Exp. ID 33234
Forward primer (5'-3')
TGAAGACACTCCTCTCTCTGAATGGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGCTATGGATCTAGGTACCCAAG
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 1100
Approximate temperature
55°C
  
PCR data   Exp. ID 33235
Forward primer (5'-3')
TGAAGACACTCCTCTCTCTGAATGGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGCTATGGATCTAGGTACCCAAG
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 1200
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]

Genomic location of C2_At5g23120  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8810 marker 8810
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)