SGN Marker C2_At5g23880

SGN-M8824
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle303097 (SGN)
122556 (CGN)
---
Lycopersicon CombinedSingleSGN-U235932---
ArabidopsisSingleAt5g23880 on TAIR---
Mapped locations  
Map: Eggplant-COSII   
Map version
63 (location: 42253)
Chromosome
3
Position
65.70 cM
Confidence
F(LOD3)
Protocol
dCAPS


Eggplant-COSII

PCR data   Exp. ID 43821
Forward primer (5'-3')
AGCTAACCTAATCCTTGATACAACACC
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
TCTATTCTCATTTGTTCATGTTGAAGGTA
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Pepper-COSII   
Map version
58 (location: 41525)
Chromosome
3
Position
71.10 cM
Confidence
I(LOD2)
Protocol
CAPS


Pepper-COSII

PCR data   Exp. ID 43501
Forward primer (5'-3')
AGCTAACCTAATCCTTGATACAACACC
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
ACCATCAGAACGACCTTCGAAGTCC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38821)
Chromosome
3
Position
53.50 cM
Confidence
I(LOD2)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39947
Forward primer (5'-3')
AGCTAACCTAATCCTTGATACAACACC
Accessions and product sizes
Solanum lycopersicum TA209
400
Solanum pennellii TA56
400
Approximate temperature
55°C
Reverse primer (5'-3')
ACCATCAGAACGACCTTCGAAGTCC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 27285)
Chromosome
5
Position
8.06 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 11811
Forward primer (5'-3')
AGCTAACCTAATCCTTGATACAACACC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACCATCAGAACGACCTTCGAAGTCC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1650
Approximate temperature
55°C
  
PCR data   Exp. ID 32578
Forward primer (5'-3')
AGCTAACCTAATCCTTGATACAACACC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACCATCAGAACGACCTTCGAAGTCC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1650
Approximate temperature
53°C
  
PCR data   Exp. ID 32579
Forward primer (5'-3')
AGCTAACCTAATCCTTGATACAACACC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACCATCAGAACGACCTTCGAAGTCC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1650
Approximate temperature
53°C
  
PCR data   Exp. ID 32580
Forward primer (5'-3')
AGCTAACCTAATCCTTGATACAACACC
Digested band sizes (using TaqI)
Solanum lycopersicum LA925: 500+1150
Solanum pennellii LA716: 400+1150
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACCATCAGAACGACCTTCGAAGTCC
Enzymes
All possible enzymes for pennellii and and lycopersicum: BanII,BsiEI,TaqI
  
Accessions and product sizes
Solanum lycopersicum LA925: 1650
Solanum pennellii LA716: 1650
Approximate temperature
53°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Amplicon sequence alignment, FASTA
At5g23880F.cds.txt, plain text
Forward amplicon sequence for S. lycopersicum TA209, AB1 chromatogram - [View]
Forward amplicon sequence for S. lycopersicum TA209, plain text
Forward amplicon sequence for S. pennellii TA56, AB1 chromatogram - [View]
Forward amplicon sequence for S. pennellii TA56, plain text
Forward amplicon sequence for S. hirtum 130005 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, plain text
Forward amplicon sequence for S. quitoense plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #1, plain text
Forward amplicon sequence for S. betaceum 04T130, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 04T130, plain text
Forward amplicon sequence for S. betaceum 04T132, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 04T132, plain text
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text
Forward amplicon sequence for S. quitoense SE plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense SE plant #1, plain text


Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Amplicon sequence alignment, FASTA
At5g23880F.cds.txt, plain text
Forward amplicon sequence for S. lycopersicum TA209, AB1 chromatogram - [View]
Forward amplicon sequence for S. lycopersicum TA209, plain text
Forward amplicon sequence for S. pennellii TA56, AB1 chromatogram - [View]
Forward amplicon sequence for S. pennellii TA56, plain text
Forward amplicon sequence for S. hirtum 130005 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, plain text
Forward amplicon sequence for S. quitoense plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #1, plain text
Forward amplicon sequence for S. betaceum 04T130, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 04T130, plain text
Forward amplicon sequence for S. betaceum 04T132, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 04T132, plain text
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text
Forward amplicon sequence for S. quitoense SE plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense SE plant #1, plain text

Genomic location of C2_At5g23880  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8824 marker 8824
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)