SGN Marker C2_At5g23940

SGN-M8825
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle304874 (SGN)
119854 (CGN)
---
Capsicum annuumSingleSGN-U197044---
Lycopersicon CombinedMultipleSGN-U214502---
Solanum tuberosumSingleSGN-U244501---
ArabidopsisSingleAt5g23940 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38822)
Chromosome
3
Position
54.70 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 41760
Forward primer (5'-3')
AACTTGCTGGAAAATTGGGAAAAGATG
Accessions and product sizes
Approximate temperature
Unknown
Reverse primer (5'-3')
TAGGTTTCCGAAGTAACTCTCCGGC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 27286)
Chromosome
5
Position
8.08 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 11812
Forward primer (5'-3')
TAGGCCTCTACTCGCCGTACAGC
 
 
Mg+2 concentration
3mM
Reverse primer (5'-3')
TTAGTTCTTTCGAGGAAAGGTGGG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 100
Approximate temperature
53°C
  
PCR data   Exp. ID 11813
Forward primer (5'-3')
TAGGCCTCTACTCGCCGTACAGC
 
 
Mg+2 concentration
3mM
Reverse primer (5'-3')
TTAGTTCTTTCGAGGAAAGGTGGG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 150
Approximate temperature
53°C
  
PCR data   Exp. ID 11814
Forward primer (5'-3')
TAGGCCTCTACTCGCCGTACAGC
 
 
Mg+2 concentration
3mM
Reverse primer (5'-3')
TTAGTTCTTTCGAGGAAAGGTGGG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 150
Approximate temperature
53°C
  
PCR data   Exp. ID 13798
Forward primer (5'-3')
TAGGCCTCTACTCGCCGTACAGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTAGTTCTTTCGAGGAAAGGTGGG
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: 200
Approximate temperature
55°C
  
PCR data   Exp. ID 13799
Forward primer (5'-3')
TAGGCCTCTACTCGCCGTACAGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTAGTTCTTTCGAGGAAAGGTGGG
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: 200
Approximate temperature
55°C
  
PCR data   Exp. ID 13800
Forward primer (5'-3')
TAGGCCTCTACTCGCCGTACAGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTAGTTCTTTCGAGGAAAGGTGGG
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: Multiple
Approximate temperature
55°C
  
PCR data   Exp. ID 13801
Forward primer (5'-3')
TAGGCCTCTACTCGCCGTACAGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTAGTTCTTTCGAGGAAAGGTGGG
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: Multiple
Approximate temperature
55°C
  
PCR data   Exp. ID 13802
Forward primer (5'-3')
TAGGCCTCTACTCGCCGTACAGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTAGTTCTTTCGAGGAAAGGTGGG
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 200
Approximate temperature
55°C
  
PCR data   Exp. ID 13803
Forward primer (5'-3')
TAGGCCTCTACTCGCCGTACAGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTAGTTCTTTCGAGGAAAGGTGGG
Enzymes
  
Accessions and product sizes
Nicotiana plumbaginifolia TA3354: 200
Approximate temperature
55°C
  
PCR data   Exp. ID 13804
Forward primer (5'-3')
TAGGCCTCTACTCGCCGTACAGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTAGTTCTTTCGAGGAAAGGTGGG
Enzymes
  
Accessions and product sizes
Physalis TA1367: 200
Approximate temperature
55°C
  
PCR data   Exp. ID 13805
Forward primer (5'-3')
TAGGCCTCTACTCGCCGTACAGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTAGTTCTTTCGAGGAAAGGTGGG
Enzymes
  
Accessions and product sizes
Petunia axillaris TA3309: Multiple
Approximate temperature
55°C
  
PCR data   Exp. ID 13806
Forward primer (5'-3')
TAGGCCTCTACTCGCCGTACAGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTAGTTCTTTCGAGGAAAGGTGGG
Enzymes
  
Accessions and product sizes
Petunia x hybrida TA3311: Multiple
Approximate temperature
55°C
  
PCR data   Exp. ID 13807
Forward primer (5'-3')
TAGGCCTCTACTCGCCGTACAGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTAGTTCTTTCGAGGAAAGGTGGG
Enzymes
  
Accessions and product sizes
Petunia integrifolia TA3312: Multiple
Approximate temperature
55°C
  
PCR data   Exp. ID 32656
Forward primer (5'-3')
TAGGCCTCTACTCGCCGTACAGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTAGTTCTTTCGAGGAAAGGTGGG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 200+450
Approximate temperature
55°C
  
PCR data   Exp. ID 33236
Forward primer (5'-3')
TAGGCCTCTACTCGCCGTACAGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTAGTTCTTTCGAGGAAAGGTGGG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 200+450
Approximate temperature
55°C
  
PCR data   Exp. ID 33237
Forward primer (5'-3')
TAGGCCTCTACTCGCCGTACAGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTAGTTCTTTCGAGGAAAGGTGGG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 200+450
Approximate temperature
55°C
  
PCR data   Exp. ID 33238
Forward primer (5'-3')
TAGGCCTCTACTCGCCGTACAGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTAGTTCTTTCGAGGAAAGGTGGG
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: Multiple
Approximate temperature
55°C
  
PCR data   Exp. ID 33239
Forward primer (5'-3')
TAGGCCTCTACTCGCCGTACAGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTAGTTCTTTCGAGGAAAGGTGGG
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: Multiple
Approximate temperature
55°C
  
PCR data   Exp. ID 33240
Forward primer (5'-3')
TAGGCCTCTACTCGCCGTACAGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTAGTTCTTTCGAGGAAAGGTGGG
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 200
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]

Genomic location of C2_At5g23940  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8825 marker 8825
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)