Notice: The FTP site is available again. We apologize for any inconvenience.

SGN Marker C2_At5g24120

SGN-M8829
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle304910 (SGN)
120424 (CGN)
---
Lycopersicon CombinedSingleSGN-U220601---
Solanum tuberosumSingleSGN-U256756---
ArabidopsisSingleAt5g24120 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38823)
Chromosome
3
Position
44.50 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 41762
Forward primer (5'-3')
TGCAAATGCGTCAAGATTCCAAGACC
Accessions and product sizes
Approximate temperature
Unknown
Reverse primer (5'-3')
AGCTCAAACAGCAACTCCAACTTGGC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 27290)
Chromosome
5
Position
8.16 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At5g24120  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8829 marker 8829
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)