SGN Marker C2_At5g26360

SGN-M8848
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeMultiple299259 (SGN)
122506 (CGN)
---
Capsicum annuumSingleSGN-U198801---
Lycopersicon CombinedSingleSGN-U217772---
Solanum tuberosumMultipleSGN-U245359---
ArabidopsisSingleAt5g26360 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38832)
Chromosome
5
Position
119.00 cM
Confidence
I(LOD2)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39952
Forward primer (5'-3')
TAGTTCCCGGTGGTGGTGCAAC
Accessions and product sizes
Solanum pennellii TA56
650
Solanum lycopersicum TA209
650
Approximate temperature
55°C
Reverse primer (5'-3')
TCAAAAGCAATTGCAGCAGCTTC
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
650
Solanum lycopersicum TA209
630
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 27310)
Chromosome
5
Position
9.26 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 11833
Forward primer (5'-3')
TAGTTCCCGGTGGTGGTGCAAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCAAAAGCAATTGCAGCAGCTTC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 300
Approximate temperature
55°C
  
PCR data   Exp. ID 11834
Forward primer (5'-3')
TAGTTCCCGGTGGTGGTGCAAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCAAAAGCAATTGCAGCAGCTTC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 300
Approximate temperature
55°C
  
PCR data   Exp. ID 11835
Forward primer (5'-3')
TAGTTCCCGGTGGTGGTGCAAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCAAAAGCAATTGCAGCAGCTTC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 300
Approximate temperature
55°C
  
PCR data   Exp. ID 11836
Forward primer (5'-3')
TAGTTCCCGGTGGTGGTGCAAC
Digested band sizes (using HinfI)
Solanum pennellii LA716: 100+130
Solanum lycopersicum LA925: 100+170
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCAAAAGCAATTGCAGCAGCTTC
Enzymes
All possible enzymes for pennellii and and lycopersicum: HinfI
  
Accessions and product sizes
Solanum pennellii LA716: 300
Solanum lycopersicum LA925: 300
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4, plain text
Forward amplicon sequence for S. uniloba 6002078 plant #6, AB1 chromatogram - [View]
Forward amplicon sequence for S. uniloba 6002078 plant #6, plain text

Genomic location of C2_At5g26360  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8848 marker 8848
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)