SGN Marker C2_At5g34850

SGN-M8871
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle299906 (SGN)
119709 (CGN)
---
Capsicum annuumSingleSGN-U197853---
Lycopersicon CombinedMultipleSGN-U214941---
Solanum tuberosumSingleSGN-U248351---
ArabidopsisSingleAt5g34850 on TAIR---
Mapped locations  
Map: Tobacco N. acuminata   
Map version
89 (location: 46532)
Chromosome
11
Position
13.40 cM
Confidence
F(LOD3)
Protocol
CAPS


Tobacco N. acuminata

Map: Pepper-COSII   
Map version
58 (location: 41528)
Chromosome
7
Position
41.50 cM
Confidence
I
Protocol
PCR


Pepper-COSII

PCR data   Exp. ID 43504
Forward primer (5'-3')
AGTGAAGTGGCTACATCCAAAATCTC
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
GAACAAAACATGCCCTACTGTAGGAA
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38840)
Chromosome
7
Position
0.40 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 41783
Forward primer (5'-3')
AACTCAGTTTCCGTCTGTTGATATTCC
Accessions and product sizes
Approximate temperature
Unknown
Reverse primer (5'-3')
TCCTTTTCCAATTTCATAGTAGTACTT
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 27334)
Chromosome
5
Position
13.13 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At5g34850  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8871 marker 8871
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)