SGN Marker C2_At5g37850

SGN-M8892
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle309754 (SGN)
127142 (CGN)
---
Capsicum annuumSingleSGN-U204878---
Lycopersicon CombinedSingleSGN-U229241---
Solanum tuberosumSingleSGN-U254542---
ArabidopsisSingleAt5g37850 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38849)
Chromosome
2
Position
119.50 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39959
Forward primer (5'-3')
TGGACCCAATCAATTCTGTACAGTTCTC
Accessions and product sizes
Solanum lycopersicum TA209
650
Solanum pennellii TA56
650
Approximate temperature
55°C
Reverse primer (5'-3')
TCCCTTAAAGGTTGGGTATCCTGTG
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
550
Solanum pennellii TA56
420
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 27357)
Chromosome
5
Position
15.08 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 11865
Forward primer (5'-3')
TGGACCCAATCAATTCTGTACAGTTCTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCCTTAAAGGTTGGGTATCCTGTG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 200
Approximate temperature
55°C
  
PCR data   Exp. ID 11866
Forward primer (5'-3')
TGGACCCAATCAATTCTGTACAGTTCTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCCTTAAAGGTTGGGTATCCTGTG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 200
Approximate temperature
55°C
  
PCR data   Exp. ID 11867
Forward primer (5'-3')
TGGACCCAATCAATTCTGTACAGTTCTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCCTTAAAGGTTGGGTATCCTGTG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 200
Approximate temperature
55°C
  
PCR data   Exp. ID 11868
Forward primer (5'-3')
TGGACCCAATCAATTCTGTACAGTTCTC
Digested band sizes (using TaqI)
Solanum pennellii LA716: 150
Solanum lycopersicum LA925: 200
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCCTTAAAGGTTGGGTATCCTGTG
Enzymes
All possible enzymes for pennellii and and lycopersicum: TaqI
  
Accessions and product sizes
Solanum lycopersicum LA925: 200
Solanum pennellii LA716: 200
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]

Genomic location of C2_At5g37850  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8892 marker 8892
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)