SGN Marker C2_At5g38530

SGN-M8896
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
Lycopersicon CombinedSingleSGN-U215849---
Solanum tuberosumSingleSGN-U249761---
ArabidopsisSingleAt5g38530 on TAIR---
Mapped locations  
Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46767)
Chromosome
12
Position
33.40 cM
Confidence
F(LOD3)
Protocol
CAPS


Tobacco N. tomentosiformis

Map: Pepper-COSII   
Map version
58 (location: 41530)
Chromosome
12
Position
98.00 cM
Confidence
F(LOD3)
Protocol
dCAPS


Pepper-COSII

PCR data   Exp. ID 43506
Forward primer (5'-3')
TTGTATTGTGAATCGCCTATATGT
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
ACTCCTCACCGATAACGGTCTGATG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38850)
Chromosome
12
Position
93.00 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39960
Forward primer (5'-3')
TCGCACAAGCCCAACTCTGCTG
Accessions and product sizes
Solanum pennellii TA56
700
Solanum lycopersicum TA209
700
Approximate temperature
55°C
Reverse primer (5'-3')
ACTCCTCACCGATAACGGTCTGATG
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
550
Solanum pennellii TA56
700
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 27361)
Chromosome
5
Position
15.44 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 11869
Forward primer (5'-3')
TCGCACAAGCCCAACTCTGCTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACTCCTCACCGATAACGGTCTGATG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 450
Approximate temperature
55°C
  
PCR data   Exp. ID 11870
Forward primer (5'-3')
TCGCACAAGCCCAACTCTGCTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACTCCTCACCGATAACGGTCTGATG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 450
Approximate temperature
55°C
  
PCR data   Exp. ID 11871
Forward primer (5'-3')
TCGCACAAGCCCAACTCTGCTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACTCCTCACCGATAACGGTCTGATG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 450
Approximate temperature
55°C
  
PCR data   Exp. ID 11872
Forward primer (5'-3')
TCGCACAAGCCCAACTCTGCTG
Digested band sizes (using TspRI)
Solanum pennellii LA716: 410
Solanum lycopersicum LA925: 450
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACTCCTCACCGATAACGGTCTGATG
Enzymes
All possible enzymes for pennellii and and lycopersicum: AvaII,BclI,BglI,DpnII,HinfI,RsaI,Sau96I,TspRI,XcmI
All possible enzymes for lycopersicum and pimpinellifolium: MspI,NciI,ScrFI
  
Accessions and product sizes
Solanum pennellii LA716: 450
Solanum lycopersicum LA925: 450
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Amplicon sequence alignment, FASTA
At5g38530F.cds.txt, plain text
Forward amplicon sequence for S. pimpinellifolium LA1589, AB1 chromatogram - [View]
Forward amplicon sequence for S. pimpinellifolium LA1589, plain text
Forward amplicon sequence for S. lycopersicum TA209, AB1 chromatogram - [View]
Forward amplicon sequence for S. lycopersicum TA209, plain text
Forward amplicon sequence for S. pennellii TA56, AB1 chromatogram - [View]
Forward amplicon sequence for S. pennellii TA56, plain text

Genomic location of C2_At5g38530  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8896 marker 8896
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)