SGN Marker C2_At5g41480

SGN-M8924
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
Lycopersicon CombinedSingleSGN-U224844---
Solanum tuberosumSingleSGN-U262041---
ArabidopsisSingleAt5g41480 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38859)
Chromosome
6
Position
26.00 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39966
Forward primer (5'-3')
TATTCGTGCTGGTCTGGAGAGTGC
Accessions and product sizes
Solanum lycopersicum TA209
650
Solanum pennellii TA56
650
Approximate temperature
55°C
Reverse primer (5'-3')
ATGATCCTTGTCATTCGCCATAGC
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
250
Solanum lycopersicum TA209
350
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 27389)
Chromosome
5
Position
16.61 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 11895
Forward primer (5'-3')
TATTCGTGCTGGTCTGGAGAGTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATGATCCTTGTCATTCGCCATAGC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 330
Approximate temperature
55°C
  
PCR data   Exp. ID 11896
Forward primer (5'-3')
TATTCGTGCTGGTCTGGAGAGTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATGATCCTTGTCATTCGCCATAGC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 330
Approximate temperature
55°C
  
PCR data   Exp. ID 11897
Forward primer (5'-3')
TATTCGTGCTGGTCTGGAGAGTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATGATCCTTGTCATTCGCCATAGC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 330
Approximate temperature
55°C
  
PCR data   Exp. ID 11898
Forward primer (5'-3')
TATTCGTGCTGGTCTGGAGAGTGC
Digested band sizes (using Hpy188I)
Solanum lycopersicum LA925: 250
Solanum pennellii LA716: 330
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATGATCCTTGTCATTCGCCATAGC
Enzymes
All possible enzymes for pennellii and and lycopersicum: Hpy188I,Tsp509I
All possible enzymes for lycopersicum and pimpinellifolium: BstNSI/NspI/XceI,FauNDI/NdeI,NlaIII/FatI/CviAII/Hin1II/Hsp92II
  
Accessions and product sizes
Solanum pennellii LA716: 330
Solanum lycopersicum LA925: 330
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Amplicon sequence alignment, FASTA
At5g41480F.cds.txt, plain text
Forward amplicon sequence for S. pimpinellifolium LA1589, AB1 chromatogram - [View]
Forward amplicon sequence for S. pimpinellifolium LA1589, plain text
Forward amplicon sequence for S. lycopersicum TA209, AB1 chromatogram - [View]
Forward amplicon sequence for S. lycopersicum TA209, plain text
Forward amplicon sequence for S. pennellii TA56, AB1 chromatogram - [View]
Forward amplicon sequence for S. pennellii TA56, plain text
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text

Genomic location of C2_At5g41480  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8924 marker 8924
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)