SGN Marker SSR222

SGN-M895

SynonymsNone
Locus associationsNone
SSR info 

Annealing temperatures: Low: 50 High: 50
Repeat motif: TCT   Repeat number: 7
Repeat motif:    Repeat number:
Forward primer: TCTCATCTGGTGCTGCTGTT
Reverse primer: TTCTTGGAGGACCCAGAAAC
Predicted size: 183
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39192)
Chromosome
1
Position
97.50 cM
Confidence
I(LOD2)
Protocol
SSR


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 14079
Forward primer (5'-3')
TCTCATCTGGTGCTGCTGTT
 
 
Mg+2 concentration
Unknown
Reverse primer (5'-3')
TTCTTGGAGGACCCAGAAAC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 160+183
Solanum lycopersicum LA925: 162+183
Approximate temperature
55°C
  
PCR data   Exp. ID 11
Forward primer (5'-3')
TCTCATCTGGTGCTGCTGTT
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTCTTGGAGGACCCAGAAAC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 163+175
Solanum lycopersicum LA925: 163+163
Approximate temperature
55°C
  
Overgo hybridization and physical mapping 
SSR222 was used as an overgo probe on plate 8 [well E8]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
CAGCAACAGTCAACTGTTTCTGGG
B sequence
TGTGGTTCTTGGAGGACCCAGAAA
AB sequence
CAGCAACAGTCAACTGTTTCTGGGTCCTCC
Marker sequence
GGAACAACTTTTCTTCAAGATTCAGAAAAAATGGCAGCAATAATCTCATC
TGGTGCTGCTGTTACAACTCTTTCTTTAACCTTCACACCAAAACCCATTT
CATCATCTTCTTCTTCTTCTTCTTCTCCTTCACTGTTTGTTTCAACACCC
AAGATTCAAACTTTATGTTCCTCTAGCTCACTTTTCTTCAACAGCAACAG
TCAACTGTTTCTGGGTCCTCCAAGAACCACAAGAAAAGTAAGGAGCAACA
GCAAAAGAGGTCTTTCTTGTTACTGTTTATTTGGACTTGGAGTCCCTGAG
CTGGCGGTGATTGCTGGTGTTGCTGCTCTTGTTTTTGGGCCCAAACAGTT
ACCTGAAGTTGGCCGCACTATTGGCAAGACTGTCAAGAGTTTCCAACAGG
CTGCAAAGGAGTTTGAAACTGAGTTGAGAAAGGAACCCGATGCCTCTGCT
CAGCCCCCAGTCGAAAAGGCCATTGAGGGAAGTCAAGAAGAGAAGCAAGA
CACAAAGGTTTCAAGCACCAAGGAGAGTTCATAAAACCATAAATG
Genomic location of SSR222  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D895 marker 895
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)