SGN Marker C2_At5g43940

SGN-M8952
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeMultiple299947 (SGN)
121348 (CGN)
---
Capsicum annuumSingleSGN-U196715---
Lycopersicon CombinedMultipleSGN-U213713---
Solanum tuberosumSingleSGN-U244182---
ArabidopsisSingleAt5g43940 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38864)
Chromosome
9
Position
47.00 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39969
Forward primer (5'-3')
ATGTGTTCTTGGTCATGAGGCTGC
Accessions and product sizes
Solanum lycopersicum TA209
1850
Approximate temperature
Unknown
Reverse primer (5'-3')
TCTTACGGTCGTTCATCATAACTCC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 27418)
Chromosome
5
Position
17.70 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 11909
Forward primer (5'-3')
ATGTGTTCTTGGTCATGAGGCTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCTTACGGTCGTTCATCATAACTCC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 350
Approximate temperature
55°C
  
PCR data   Exp. ID 11910
Forward primer (5'-3')
ATGTGTTCTTGGTCATGAGGCTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCTTACGGTCGTTCATCATAACTCC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 350
Approximate temperature
55°C
  
PCR data   Exp. ID 11911
Forward primer (5'-3')
ATGTGTTCTTGGTCATGAGGCTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCTTACGGTCGTTCATCATAACTCC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 350
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]

Amplicon sequence alignment, FASTA
At5g43940F.cds.txt, plain text
Forward amplicon sequence for S. lycopersicum TA209, AB1 chromatogram - [View]
Forward amplicon sequence for S. lycopersicum TA209, plain text
Forward amplicon sequence for S. pennellii TA56, AB1 chromatogram - [View]
Forward amplicon sequence for S. pennellii TA56, plain text

Genomic location of C2_At5g43940  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8952 marker 8952
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)