SGN Marker C2_At5g45680

SGN-M8967
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle307685 (SGN)
129306 (CGN)
---
Lycopersicon CombinedSingleSGN-U220250---
Solanum tuberosumMultipleSGN-U260724---
ArabidopsisSingleAt5g45680 on TAIR---
Mapped locations  
Map: Eggplant-COSII   
Map version
63 (location: 42256)
Chromosome
8
Position
18.50 cM
Confidence
F(LOD3)
Protocol
dCAPS


Eggplant-COSII

PCR data   Exp. ID 43825
Forward primer (5'-3')
AGTAATATACTATGTTTCTTCTGGAAGC
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
ACCTCCTAGAATTCCCTGATCCC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Pepper-COSII   
Map version
58 (location: 41537)
Chromosome
1
Position
160.80 cM
Confidence
I
Protocol
CAPS


Pepper-COSII

PCR data   Exp. ID 43513
Forward primer (5'-3')
TCTTACATTTCGCGTTGGTGTTGG
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
ACCTCCTAGAATTCCCTGATCCC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38868)
Chromosome
8
Position
3.70 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39972
Forward primer (5'-3')
TCTTACATTTCGCGTTGGTGTTGG
Accessions and product sizes
Solanum lycopersicum TA209
250
Solanum pennellii TA56
250
Approximate temperature
55°C
Reverse primer (5'-3')
ACCTCCTAGAATTCCCTGATCCC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 27434)
Chromosome
5
Position
18.55 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 11922
Forward primer (5'-3')
TCTTACATTTCGCGTTGGTGTTGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACCTCCTAGAATTCCCTGATCCC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 800
Approximate temperature
55°C
  
PCR data   Exp. ID 11923
Forward primer (5'-3')
TCTTACATTTCGCGTTGGTGTTGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACCTCCTAGAATTCCCTGATCCC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 800
Approximate temperature
55°C
  
PCR data   Exp. ID 11924
Forward primer (5'-3')
TCTTACATTTCGCGTTGGTGTTGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACCTCCTAGAATTCCCTGATCCC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 800
Approximate temperature
55°C
  
PCR data   Exp. ID 11925
Forward primer (5'-3')
TCTTACATTTCGCGTTGGTGTTGG
Digested band sizes (using TaqI)
Solanum lycopersicum LA925: 750
Solanum pennellii LA716: 350+440
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACCTCCTAGAATTCCCTGATCCC
Enzymes
All possible enzymes for pennellii and and lycopersicum: TaqI
All possible enzymes for lycopersicum and pimpinellifolium: DpnII
  
Accessions and product sizes
Solanum lycopersicum LA925: 800
Solanum pennellii LA716: 800
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text

Genomic location of C2_At5g45680  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8967 marker 8967
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)