SGN Marker C2_At5g47010

SGN-M8977
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle304308 (SGN)
123224 (CGN)
---
Capsicum annuumMultipleSGN-U200255---
Lycopersicon CombinedSingleSGN-U225682---
Solanum tuberosumSingleSGN-U253131---
ArabidopsisSingleAt5g47010 on TAIR---
Mapped locations  
Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46773)
Chromosome
8
Position
66.30 cM
Confidence
F(LOD3)
Protocol
CAPS


Tobacco N. tomentosiformis

Map: Eggplant-COSII   
Map version
63 (location: 42258)
Chromosome
8
Position
77.00 cM
Confidence
F(LOD3)
Protocol
CAPS


Eggplant-COSII

PCR data   Exp. ID 43827
Forward primer (5'-3')
ACCGCAGGCTTTTCTTTGGTGG
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
TGGATGGACGAGGTGCCATGTAAG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Pepper-COSII   
Map version
58 (location: 41538)
Chromosome
1
Position
52.20 cM
Confidence
I
Protocol
CAPS


Pepper-COSII

PCR data   Exp. ID 43514
Forward primer (5'-3')
ACCGCAGGCTTTTCTTTGGTGG
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
TGGATGGACGAGGTGCCATGTAAG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38874)
Chromosome
8
Position
55.70 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39976
Forward primer (5'-3')
ACCGCAGGCTTTTCTTTGGTGG
Accessions and product sizes
Solanum lycopersicum TA209
150
Solanum pennellii TA56
150
Approximate temperature
55°C
Reverse primer (5'-3')
TGGATGGACGAGGTGCCATGTAAG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 27444)
Chromosome
5
Position
19.09 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 11933
Forward primer (5'-3')
ACCGCAGGCTTTTCTTTGGTGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGGATGGACGAGGTGCCATGTAAG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 750
Approximate temperature
55°C
  
PCR data   Exp. ID 11934
Forward primer (5'-3')
ACCGCAGGCTTTTCTTTGGTGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGGATGGACGAGGTGCCATGTAAG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 750
Approximate temperature
55°C
  
PCR data   Exp. ID 11935
Forward primer (5'-3')
ACCGCAGGCTTTTCTTTGGTGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGGATGGACGAGGTGCCATGTAAG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 750
Approximate temperature
55°C
  
PCR data   Exp. ID 11936
Forward primer (5'-3')
ACCGCAGGCTTTTCTTTGGTGG
Digested band sizes (using RsaI)
Solanum lycopersicum LA925: 320+420
Solanum pennellii LA716: 300
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGGATGGACGAGGTGCCATGTAAG
Enzymes
All possible enzymes for pennellii and and lycopersicum: RsaI, HinfI
  
Accessions and product sizes
Solanum lycopersicum LA925: 750
Solanum pennellii LA716: 750
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]
Forward amplicon sequence for S. betaceum 285028 plant #2, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 285028 plant #2, plain text
Forward amplicon sequence for S. betaceum 6002056 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002056 plant #1, plain text
Forward amplicon sequence for S. betaceum 6002061 plant #4, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4, plain text

Genomic location of C2_At5g47010  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8977 marker 8977
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)