SGN Marker C2_At5g48030

SGN-M8991
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle303842 (SGN)
122179 (CGN)
---
Solanum tuberosumSingleSGN-U266411---
ArabidopsisSingleAt5g48030 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38876)
Chromosome
1
Position
46.40 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39978
Forward primer (5'-3')
TGTATGGAAGTGGTGGAGCAGATCC
Accessions and product sizes
Solanum pennellii TA56
800
Solanum lycopersicum TA209
800
Approximate temperature
55°C
Reverse primer (5'-3')
AGCCTTCTCTCCGGAAAACAGG
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
350+440
Solanum lycopersicum TA209
750
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 27458)
Chromosome
5
Position
19.49 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 11947
Forward primer (5'-3')
TGTATGGAAGTGGTGGAGCAGATCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCCTTCTCTCCGGAAAACAGG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 150
Approximate temperature
55°C
  
PCR data   Exp. ID 11948
Forward primer (5'-3')
TGTATGGAAGTGGTGGAGCAGATCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCCTTCTCTCCGGAAAACAGG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 150
Approximate temperature
55°C
  
PCR data   Exp. ID 11949
Forward primer (5'-3')
TGTATGGAAGTGGTGGAGCAGATCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCCTTCTCTCCGGAAAACAGG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 150
Approximate temperature
55°C
  
PCR data   Exp. ID 11950
Forward primer (5'-3')
TGTATGGAAGTGGTGGAGCAGATCC
Digested band sizes (using DpnII)
Solanum lycopersicum LA925: 150
Solanum pennellii LA716: 125
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCCTTCTCTCCGGAAAACAGG
Enzymes
All possible enzymes for pennellii and and lycopersicum: DpnII
  
Accessions and product sizes
Solanum pennellii LA716: 150
Solanum lycopersicum LA925: 150
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format

Genomic location of C2_At5g48030  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8991 marker 8991
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)