SGN Marker C2_At5g48330

SGN-M8993
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
Lycopersicon CombinedSingleSGN-U242632---
Solanum tuberosumSingleSGN-U266826---
ArabidopsisSingleAt5g48330 on TAIR---
Mapped locations  
Map: Arabidopsis COSII   
Map version
44 (location: 27460)
Chromosome
5
Position
19.60 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII

PCR data   Exp. ID 41831
Forward primer (5'-3')
TCCCGCCGATGGATGAGCAG
Accessions and product sizes
Solanum pennellii TA56
250
Solanum lycopersicum TA209
250
Approximate temperature
55°C
Reverse primer (5'-3')
TCCCTTGCCAAGACCAAGCTG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  
Other PCR data 
PCR data   Exp. ID 11953
Forward primer (5'-3')
TCCCGCCGATGGATGAGCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCCTTGCCAAGACCAAGCTG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 2000
Approximate temperature
55°C
  
PCR data   Exp. ID 11954
Forward primer (5'-3')
TCCCGCCGATGGATGAGCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCCTTGCCAAGACCAAGCTG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 2000
Approximate temperature
55°C
  
PCR data   Exp. ID 11955
Forward primer (5'-3')
TCCCGCCGATGGATGAGCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCCTTGCCAAGACCAAGCTG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 2000
Approximate temperature
55°C
  
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Amplicon sequence alignment, FASTA
At5g48330F.cds.txt, plain text
Forward amplicon sequence for S. pimpinellifolium LA1589, AB1 chromatogram - [View]
Forward amplicon sequence for S. pimpinellifolium LA1589, plain text
Forward amplicon sequence for S. lycopersicum TA209, AB1 chromatogram - [View]
Forward amplicon sequence for S. lycopersicum TA209, plain text
Forward amplicon sequence for S. pennellii TA56, AB1 chromatogram - [View]
Forward amplicon sequence for S. pennellii TA56, plain text

Genomic location of C2_At5g48330  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8993 marker 8993
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)