SGN Marker C2_At5g49480

SGN-M9012
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
Capsicum annuumMultipleSGN-U199261---
Lycopersicon CombinedSingleSGN-U220721---
Solanum tuberosumSingleSGN-U258582---
ArabidopsisSingleAt5g49480 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38878)
Chromosome
1
Position
31.60 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39980
Forward primer (5'-3')
ACCAAATCTGCGGTCAGCATTCG
Accessions and product sizes
Solanum pennellii TA56
300
Solanum lycopersicum TA209
300
Approximate temperature
55°C
Reverse primer (5'-3')
TTGAAGAAAACCTTGATAGGTAACACC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 27479)
Chromosome
5
Position
20.09 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 11956
Forward primer (5'-3')
ACCAAATCTGCGGTCAGCATTCG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTGAAGAAAACCTTGATAGGTAACACC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 400
Approximate temperature
55°C
  
PCR data   Exp. ID 11957
Forward primer (5'-3')
ACCAAATCTGCGGTCAGCATTCG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTGAAGAAAACCTTGATAGGTAACACC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 400
Approximate temperature
55°C
  
PCR data   Exp. ID 11958
Forward primer (5'-3')
ACCAAATCTGCGGTCAGCATTCG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTGAAGAAAACCTTGATAGGTAACACC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 430
Approximate temperature
55°C
  
PCR data   Exp. ID 32583
Forward primer (5'-3')
ACCAAATCTGCGGTCAGCATTCG
Digested band sizes (using EcoRV)
Solanum lycopersicum LA925: 360
Solanum pennellii LA716: 400
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTGAAGAAAACCTTGATAGGTAACACC
Enzymes
All possible enzymes for pennellii and and lycopersicum: EcoRV
  
Accessions and product sizes
Solanum pennellii LA716: 400
Solanum lycopersicum LA925: 400
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Amplicon sequence alignment, FASTA
At5g49480F.cds.txt, plain text
Forward amplicon sequence for S. pimpinellifolium LA1589, AB1 chromatogram - [View]
Forward amplicon sequence for S. pimpinellifolium LA1589, PDF chromatogram
Forward amplicon sequence for S. pimpinellifolium LA1589, plain text
Forward amplicon sequence for S. lycopersicum TA209, AB1 chromatogram - [View]
Forward amplicon sequence for S. lycopersicum TA209, PDF chromatogram
Forward amplicon sequence for S. lycopersicum TA209, plain text
Forward amplicon sequence for S. pennellii TA56, AB1 chromatogram - [View]
Forward amplicon sequence for S. pennellii TA56, PDF chromatogram
Forward amplicon sequence for S. pennellii TA56, plain text

Genomic location of C2_At5g49480  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D9012 marker 9012
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)