SGN Marker C2_At5g49830

SGN-M9018
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle302572 (SGN)
123768 (CGN)
---
Capsicum annuumSingleSGN-U202436---
Lycopersicon CombinedSingleSGN-U220665---
Solanum tuberosumSingleSGN-U266390---
ArabidopsisSingleAt5g49830 on TAIR---
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49303)
Chromosome
3
Position
64.61 MB
Confidence
uncalculated
Protocol
CAPS


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47243)
Chromosome
3
Position
133.51 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38880)
Chromosome
3
Position
167.50 cM
Confidence
F(LOD3)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39982
Forward primer (5'-3')
ACGCTACTTATCTAGAAATTTGCTTC
Accessions and product sizes
Solanum lycopersicum TA209
850
Solanum pennellii TA56
850
Approximate temperature
55°C
Reverse primer (5'-3')
TCAATAACTCCCATGAGATCTGACAG
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
320+420
Solanum pennellii TA56
320+520
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 27486)
Chromosome
5
Position
20.27 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 11966
Forward primer (5'-3')
ACGCTACTTATCTAGAAATTTGCTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCAATAACTCCCATGAGATCTGACAG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 450
Approximate temperature
55°C
  
PCR data   Exp. ID 11967
Forward primer (5'-3')
ACGCTACTTATCTAGAAATTTGCTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCAATAACTCCCATGAGATCTGACAG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 450
Approximate temperature
55°C
  
PCR data   Exp. ID 11968
Forward primer (5'-3')
ACGCTACTTATCTAGAAATTTGCTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCAATAACTCCCATGAGATCTGACAG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 450
Approximate temperature
55°C
  
PCR data   Exp. ID 13869
Forward primer (5'-3')
ACGCTACTTATCTAGAAATTTGCTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCAATAACTCCCATGAGATCTGACAG
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 13870
Forward primer (5'-3')
ACGCTACTTATCTAGAAATTTGCTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCAATAACTCCCATGAGATCTGACAG
Enzymes
  
Accessions and product sizes
Solanum melongena TA2986: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 13871
Forward primer (5'-3')
ACGCTACTTATCTAGAAATTTGCTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCAATAACTCCCATGAGATCTGACAG
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 13872
Forward primer (5'-3')
ACGCTACTTATCTAGAAATTTGCTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCAATAACTCCCATGAGATCTGACAG
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 13873
Forward primer (5'-3')
ACGCTACTTATCTAGAAATTTGCTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCAATAACTCCCATGAGATCTGACAG
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 13874
Forward primer (5'-3')
ACGCTACTTATCTAGAAATTTGCTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCAATAACTCCCATGAGATCTGACAG
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 13875
Forward primer (5'-3')
ACGCTACTTATCTAGAAATTTGCTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCAATAACTCCCATGAGATCTGACAG
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 13876
Forward primer (5'-3')
ACGCTACTTATCTAGAAATTTGCTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCAATAACTCCCATGAGATCTGACAG
Enzymes
  
Accessions and product sizes
Physalis TA1367: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 13877
Forward primer (5'-3')
ACGCTACTTATCTAGAAATTTGCTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCAATAACTCCCATGAGATCTGACAG
Enzymes
  
Accessions and product sizes
Petunia axillaris subsp. parodii TA3310: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 13878
Forward primer (5'-3')
ACGCTACTTATCTAGAAATTTGCTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCAATAACTCCCATGAGATCTGACAG
Enzymes
  
Accessions and product sizes
Petunia x hybrida TA3311: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 13879
Forward primer (5'-3')
ACGCTACTTATCTAGAAATTTGCTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCAATAACTCCCATGAGATCTGACAG
Enzymes
  
Accessions and product sizes
Coffea canephora BP409: 450
Approximate temperature
55°C
  
PCR data   Exp. ID 33267
Forward primer (5'-3')
ACGCTACTTATCTAGAAATTTGCTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCAATAACTCCCATGAGATCTGACAG
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 33268
Forward primer (5'-3')
ACGCTACTTATCTAGAAATTTGCTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCAATAACTCCCATGAGATCTGACAG
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 33269
Forward primer (5'-3')
ACGCTACTTATCTAGAAATTTGCTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCAATAACTCCCATGAGATCTGACAG
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 33270
Forward primer (5'-3')
ACGCTACTTATCTAGAAATTTGCTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCAATAACTCCCATGAGATCTGACAG
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 11969
Forward primer (5'-3')
ACGCTACTTATCTAGAAATTTGCTTC
Digested band sizes (using MspI)
Solanum lycopersicum LA925: 410
Solanum pennellii LA716: 450
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCAATAACTCCCATGAGATCTGACAG
Enzymes
All possible enzymes for pennellii and and lycopersicum: MspI
  
Accessions and product sizes
Solanum lycopersicum LA925: 450
Solanum pennellii LA716: 450
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]

Forward amplicon sequence for , AB1 chromatogram - [View]
Forward amplicon sequence for , plain text
Forward amplicon sequence for Physalis spp. TA1367, AB1 chromatogram - [View]
Forward amplicon sequence for Physalis spp. TA1367, plain text
Forward amplicon sequence for , AB1 chromatogram - [View]
Forward amplicon sequence for , plain text
Forward amplicon sequence for S. lycopersicum TA209, AB1 chromatogram - [View]
Forward amplicon sequence for S. lycopersicum TA209, plain text
Forward amplicon sequence for S. melongena TA2986, AB1 chromatogram - [View]
Forward amplicon sequence for S. melongena TA2986, plain text
Forward amplicon sequence for Petunia axillaris parodii TA3310, AB1 chromatogram - [View]
Forward amplicon sequence for Petunia axillaris parodii TA3310, plain text
Forward amplicon sequence for N. tomentosiformis TA3349, AB1 chromatogram - [View]
Forward amplicon sequence for N. tomentosiformis TA3349, plain text
Reverse amplicon sequence for , AB1 chromatogram - [View]
Reverse amplicon sequence for , plain text
Reverse amplicon sequence for Physalis spp. TA1367, AB1 chromatogram - [View]
Reverse amplicon sequence for Physalis spp. TA1367, plain text
Reverse amplicon sequence for , AB1 chromatogram - [View]
Reverse amplicon sequence for , plain text
Reverse amplicon sequence for S. lycopersicum TA209, AB1 chromatogram - [View]
Reverse amplicon sequence for S. lycopersicum TA209, plain text
Reverse amplicon sequence for S. melongena TA2986, AB1 chromatogram - [View]
Reverse amplicon sequence for S. melongena TA2986, plain text
Reverse amplicon sequence for Petunia axillaris parodii TA3310, AB1 chromatogram - [View]
Reverse amplicon sequence for Petunia axillaris parodii TA3310, plain text
Reverse amplicon sequence for N. tomentosiformis TA3349, AB1 chromatogram - [View]
Reverse amplicon sequence for N. tomentosiformis TA3349, plain text
Forward amplicon sequence for S. betaceum 285028 plant #2, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 285028 plant #2, plain text
Forward amplicon sequence for S. betaceum 6002056 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002056 plant #1, plain text
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text
Forward amplicon sequence for S. betaceum 6002061 plant #4, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4, plain text
Forward amplicon sequence for S. uniloba 6002078 plant #6, AB1 chromatogram - [View]
Forward amplicon sequence for S. uniloba 6002078 plant #6, plain text


BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]

Forward amplicon sequence for , AB1 chromatogram - [View]
Forward amplicon sequence for , plain text
Forward amplicon sequence for Physalis spp. TA1367, AB1 chromatogram - [View]
Forward amplicon sequence for Physalis spp. TA1367, plain text
Forward amplicon sequence for , AB1 chromatogram - [View]
Forward amplicon sequence for , plain text
Forward amplicon sequence for S. lycopersicum TA209, AB1 chromatogram - [View]
Forward amplicon sequence for S. lycopersicum TA209, plain text
Forward amplicon sequence for S. melongena TA2986, AB1 chromatogram - [View]
Forward amplicon sequence for S. melongena TA2986, plain text
Forward amplicon sequence for Petunia axillaris parodii TA3310, AB1 chromatogram - [View]
Forward amplicon sequence for Petunia axillaris parodii TA3310, plain text
Forward amplicon sequence for N. tomentosiformis TA3349, AB1 chromatogram - [View]
Forward amplicon sequence for N. tomentosiformis TA3349, plain text
Reverse amplicon sequence for , AB1 chromatogram - [View]
Reverse amplicon sequence for , plain text
Reverse amplicon sequence for Physalis spp. TA1367, AB1 chromatogram - [View]
Reverse amplicon sequence for Physalis spp. TA1367, plain text
Reverse amplicon sequence for , AB1 chromatogram - [View]
Reverse amplicon sequence for , plain text
Reverse amplicon sequence for S. lycopersicum TA209, AB1 chromatogram - [View]
Reverse amplicon sequence for S. lycopersicum TA209, plain text
Reverse amplicon sequence for S. melongena TA2986, AB1 chromatogram - [View]
Reverse amplicon sequence for S. melongena TA2986, plain text
Reverse amplicon sequence for Petunia axillaris parodii TA3310, AB1 chromatogram - [View]
Reverse amplicon sequence for Petunia axillaris parodii TA3310, plain text
Reverse amplicon sequence for N. tomentosiformis TA3349, AB1 chromatogram - [View]
Reverse amplicon sequence for N. tomentosiformis TA3349, plain text
Forward amplicon sequence for S. betaceum 285028 plant #2, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 285028 plant #2, plain text
Forward amplicon sequence for S. betaceum 6002056 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002056 plant #1, plain text
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text
Forward amplicon sequence for S. betaceum 6002061 plant #4, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4, plain text
Forward amplicon sequence for S. uniloba 6002078 plant #6, AB1 chromatogram - [View]
Forward amplicon sequence for S. uniloba 6002078 plant #6, plain text

Genomic location of C2_At5g49830  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D9018 marker 9018
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)