SGN Marker C2_At5g50720

SGN-M9027
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle304970 (SGN)
122188 (CGN)
---
Capsicum annuumSingleSGN-U200558---
Solanum tuberosumSingleSGN-U248890---
ArabidopsisSingleAt5g50720 on TAIR---
Mapped locations  
Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46775)
Chromosome
5
Position
84.90 cM
Confidence
F(LOD3)
Protocol
PCR


Tobacco N. tomentosiformis

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38883)
Chromosome
4
Position
37.50 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39985
Forward primer (5'-3')
TTGGATGATGAACAATGGCTTGC
Accessions and product sizes
Solanum lycopersicum TA209
450
Solanum pennellii TA56
450
Approximate temperature
55°C
Reverse primer (5'-3')
TGAATTGTGGAAAAACTAGCCATGC
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
450
Solanum lycopersicum TA209
410
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 27495)
Chromosome
5
Position
20.65 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 11979
Forward primer (5'-3')
TTGGATGATGAACAATGGCTTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGAATTGTGGAAAAACTAGCCATGC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 11980
Forward primer (5'-3')
TTGGATGATGAACAATGGCTTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGAATTGTGGAAAAACTAGCCATGC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 220
Approximate temperature
55°C
  
PCR data   Exp. ID 11981
Forward primer (5'-3')
TTGGATGATGAACAATGGCTTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGAATTGTGGAAAAACTAGCCATGC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 220
Approximate temperature
55°C
  
PCR data   Exp. ID 13891
Forward primer (5'-3')
TTGGATGATGAACAATGGCTTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGAATTGTGGAAAAACTAGCCATGC
Enzymes
  
Accessions and product sizes
Solanum melongena TA2986: 950
Approximate temperature
55°C
  
PCR data   Exp. ID 13892
Forward primer (5'-3')
TTGGATGATGAACAATGGCTTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGAATTGTGGAAAAACTAGCCATGC
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: 250+950
Approximate temperature
55°C
  
PCR data   Exp. ID 13893
Forward primer (5'-3')
TTGGATGATGAACAATGGCTTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGAATTGTGGAAAAACTAGCCATGC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 580+800
Approximate temperature
55°C
  
PCR data   Exp. ID 13894
Forward primer (5'-3')
TTGGATGATGAACAATGGCTTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGAATTGTGGAAAAACTAGCCATGC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 580+800
Approximate temperature
55°C
  
PCR data   Exp. ID 13895
Forward primer (5'-3')
TTGGATGATGAACAATGGCTTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGAATTGTGGAAAAACTAGCCATGC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 13896
Forward primer (5'-3')
TTGGATGATGAACAATGGCTTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGAATTGTGGAAAAACTAGCCATGC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 13897
Forward primer (5'-3')
TTGGATGATGAACAATGGCTTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGAATTGTGGAAAAACTAGCCATGC
Enzymes
  
Accessions and product sizes
Physalis TA1367: Multiple
Approximate temperature
55°C
  
PCR data   Exp. ID 13898
Forward primer (5'-3')
TTGGATGATGAACAATGGCTTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGAATTGTGGAAAAACTAGCCATGC
Enzymes
  
Accessions and product sizes
Petunia axillaris subsp. parodii TA3310: 450
Approximate temperature
55°C
  
PCR data   Exp. ID 13899
Forward primer (5'-3')
TTGGATGATGAACAATGGCTTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGAATTGTGGAAAAACTAGCCATGC
Enzymes
  
Accessions and product sizes
Petunia x hybrida TA3311: 400
Approximate temperature
55°C
  
PCR data   Exp. ID 32660
Forward primer (5'-3')
TTGGATGATGAACAATGGCTTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGAATTGTGGAAAAACTAGCCATGC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 220+750
Approximate temperature
55°C
  
PCR data   Exp. ID 33277
Forward primer (5'-3')
TTGGATGATGAACAATGGCTTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGAATTGTGGAAAAACTAGCCATGC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 220+700
Approximate temperature
55°C
  
PCR data   Exp. ID 33278
Forward primer (5'-3')
TTGGATGATGAACAATGGCTTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGAATTGTGGAAAAACTAGCCATGC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 250+750
Approximate temperature
55°C
  
PCR data   Exp. ID 33279
Forward primer (5'-3')
TTGGATGATGAACAATGGCTTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGAATTGTGGAAAAACTAGCCATGC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 580+800
Approximate temperature
55°C
  
PCR data   Exp. ID 33280
Forward primer (5'-3')
TTGGATGATGAACAATGGCTTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGAATTGTGGAAAAACTAGCCATGC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 580+800
Approximate temperature
55°C
  
PCR data   Exp. ID 33281
Forward primer (5'-3')
TTGGATGATGAACAATGGCTTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGAATTGTGGAAAAACTAGCCATGC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 33282
Forward primer (5'-3')
TTGGATGATGAACAATGGCTTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGAATTGTGGAAAAACTAGCCATGC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 11982
Forward primer (5'-3')
TTGGATGATGAACAATGGCTTGC
Digested band sizes (using amplicon difference)
Solanum pennellii LA716: 250
Solanum lycopersicum LA925: 220
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGAATTGTGGAAAAACTAGCCATGC
Enzymes
All possible enzymes for pennellii and and lycopersicum: AluI,MspI,RsaI,DraI,TaqI,RV,HaeIII,HinfI,DpnII,Kpni
All possible enzymes for lycopersicum and pimpinellifolium: amplicon difference
  
Accessions and product sizes
Solanum lycopersicum LA925: 220
Solanum pennellii LA716: 250
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]

Genomic location of C2_At5g50720  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D9027 marker 9027
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)