SGN Marker SSR231

SGN-M904

SynonymsNone
Locus associationsNone
SSR info 

Annealing temperatures: Low: 45 High: 45
Repeat motif: TA   Repeat number: 10
Repeat motif:    Repeat number:
Forward primer: TGCCAATCCACTCAGACAAA
Reverse primer: TGGATTCACCAAGGCTTCTT
Predicted size: 169
Derivations 
This marker was derived from EST read SGN-E112405
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39194)
Chromosome
3
Position
75.40 cM
Confidence
I
Protocol
SSR


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 45
Forward primer (5'-3')
TGCCAATCCACTCAGACAAA
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGGATTCACCAAGGCTTCTT
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 169+181
Solanum lycopersicum LA925: 169+169
Approximate temperature
50°C
  
Overgo hybridization and physical mapping 
SSR231 was used as an overgo probe on plate 7 [well F7]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
AACCAGCCAAAAGGCTTCATATTA
B sequence
GGGAAAGGGATGTGTTTAATATGA
AB sequence
AACCAGCCAAAAGGCTTCATATTAAACACA
Marker sequence
GATTGAAATTAGCATTCCTTGAATACATATGCATTACAGAAAATAGTACA
TGTTAAAAAACCAGCCAAAAGGCTTCATATTAAACACATCCCTTTCCCTC
CCTGAGAACAATTATTTAATCTTCCTTTATAACATCAATCTCTTCCATGT
AAAACCTAGTTCTCTTTTATTTCACAGTGATTACTAAATCATATGCCAAT
CCACTCAGACAAAGTAGAATCCCAATTACAAAATGACCATTATATATATA
TATATATATAGGGGTAAACAGTTTCACTTTTTTGGTCCTTAGGAGTTGAA
TAAATCACTTGGTGAATTCCATAATCCAAGTGTTGTAAGCACAAGAAGCC
TTGGTGAATCCATTAAATCCAGCCCCTTTAGCCAAAGCCTCAAATTCTTT
CTCAGGCCTTTCTTTGCCTCCTGGATTATGTGCTAACATTATTACATCAA
CATGTACTGTATTCTTTGTGGAAC
Genomic location of SSR231  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D904 marker 904
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)